Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027391 Escherichia coli strain 2015C-4944 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP027390 Escherichia coli strain 2015C-4944 chromosome, complete genome 7 crisprs NA 1 12 0 0

Results visualization

1. CP027390
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027390_1 815306-815429 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027390_2 2258451-2258595 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027390_3 3099413-3099545 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027390_4 3338103-3338252 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027390_5 4690112-4690229 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027390_6 5085858-5086435 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027390_7 5112137-5112592 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 CP027390.1 3338059-3338104 2 0.957

1. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to position: 3338059-3338104, mismatch: 2, identity: 0.957

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
aatgctgttattgtcggatgcggcatgaacgccttatccgacctac	Protospacer
************************.***.*****************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027390_3 3.1|3099430|42|CP027390|PILER-CR 3099430-3099471 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027390_1 1.1|815349|38|CP027390|CRISPRCasFinder 815349-815386 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027390_3 3.2|3099489|40|CP027390|PILER-CR 3099489-3099528 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95
CP027390_7 7.7|5112532|32|CP027390|PILER-CR,CRISPRCasFinder,CRT 5112532-5112563 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP019906 Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence 9269-9314 7 0.848
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 61980-62025 7 0.848
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 170867-170912 7 0.848
CP027390_6 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT 5086375-5086406 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 14045-14090 8 0.826
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 210111-210156 8 0.826
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 216136-216181 8 0.826
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 226630-226675 8 0.826
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 217464-217509 8 0.826
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 198419-198464 8 0.826
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
CP027390_6 6.8|5086314|32|CP027390|CRISPRCasFinder,CRT 5086314-5086345 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027390_6 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT 5086375-5086406 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP027390_7 7.3|5112288|32|CP027390|PILER-CR,CRISPRCasFinder,CRT 5112288-5112319 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 141173-141204 8 0.75
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
CP027390_6 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT 5085887-5085918 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
CP027390_6 6.6|5086192|32|CP027390|CRISPRCasFinder,CRT 5086192-5086223 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
CP027390_6 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT 5086375-5086406 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP027390_7 7.2|5112227|32|CP027390|PILER-CR,CRISPRCasFinder,CRT 5112227-5112258 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP027390_7 7.2|5112227|32|CP027390|PILER-CR,CRISPRCasFinder,CRT 5112227-5112258 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
CP027390_7 7.5|5112410|32|CP027390|PILER-CR,CRISPRCasFinder,CRT 5112410-5112441 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 24-69 10 0.783
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24901-24946 10 0.783
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 208940-208985 10 0.783
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 219434-219479 10 0.783
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 210268-210313 10 0.783
CP027390_4 4.1|3338155|46|CP027390|CRISPRCasFinder 3338155-3338200 46 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 191223-191268 10 0.783
CP027390_6 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT 5086375-5086406 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
CP027390_7 7.3|5112288|32|CP027390|PILER-CR,CRISPRCasFinder,CRT 5112288-5112319 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 39822-39853 10 0.688

1. spacer 3.1|3099430|42|CP027390|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 1.1|815349|38|CP027390|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 3.2|3099489|40|CP027390|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catcgcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
*** ****** *****************************

4. spacer 7.7|5112532|32|CP027390|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

5. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP019906 (Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.848

----aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
gccggatgtt----ttgtcggatgcggcgtgaacgccttatccgacctac	Protospacer
    .***.*    ******************.*****************

6. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.848

----aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
gccgaataccg----tgtcggatgcggcgtgaacgccttatccgacctac	Protospacer
    ***.*.*    *****************.*****************

7. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 7, identity: 0.848

----aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
ttagtatgc----actgtcggatgcggcgtgaacgccttatccgacctac	Protospacer
     ****    *.*****************.*****************

8. spacer 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt	Protospacer
******* ******** ******. * . ***

9. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 8, identity: 0.826

--aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
ccagcatggt--ttgtcggatgcggcgtgaacgccttatccgacctac	Protospacer
  *.... **  ******************.*****************

10. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.826

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
tcttgtgcaaatgtcggatgcggcgtgaacgccttatccgacctac	Protospacer
  *  **. * *****************.*****************

11. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.826

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
taagcaatcaatgtcggatgcggcgcgagcgccttatccgaccaac	Protospacer
 * ** .*.* **************.***************** **

12. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.826

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
taagcaatcaatgtcggatgcggcgcgagcgccttatccgaccaac	Protospacer
 * ** .*.* **************.***************** **

13. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.826

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
taagcaatcaatgtcggatgcggcgcgagcgccttatccgaccaac	Protospacer
 * ** .*.* **************.***************** **

14. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.826

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
taagcaatcaatgtcggatgcggcgcgagcgccttatccgaccaac	Protospacer
 * ** .*.* **************.***************** **

15. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcacc	Protospacer
**...*********** *** *******.* .

16. spacer 6.8|5086314|32|CP027390|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **  

17. spacer 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc	Protospacer
* ************* **** *****.  *..

18. spacer 7.3|5112288|32|CP027390|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
aattcacgatcatctttgattatccgcgaaga	Protospacer
.*  *  .****** *******.*********

19. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

20. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

21. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

22. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

23. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

24. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

25. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

26. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

27. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

28. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

29. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

30. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

31. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

32. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

33. spacer 6.1|5085887|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719

atctcctcatcctcccagctaccgacagtagt	CRISPR spacer
attctctcatcctccccgctcccgacagcgcc	Protospacer
**...*********** *** *******.. .

34. spacer 6.6|5086192|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

35. spacer 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg	Protospacer
** ************** ******..  .*  

36. spacer 7.2|5112227|32|CP027390|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaaaaacgccgtgatattgccgat	Protospacer
 **. **** *.****************   .

37. spacer 7.2|5112227|32|CP027390|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaggccgcagaacgccgtgatattgcgttc	CRISPR spacer
gcggcgccgaagaacgccgtgatgttgccggt	Protospacer
 **. **** *************.****   .

38. spacer 7.5|5112410|32|CP027390|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

atcaggtaatcgagacacctgtcagcactctc	CRISPR spacer
ccaaggtaatcgagagacctgccagcaaagcc	Protospacer
 . ************ *****.*****   .*

39. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 10, identity: 0.783

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
tcggcgcacggtgtcggatgcggcgcgagcgccttatccgacctac	Protospacer
   **   .. **************.********************

40. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.783

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
tcaggcattgatgtcggatgcggcgtaaacgccttatccgacctac	Protospacer
   * ..**. ***************.*.*****************

41. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.783

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
tctgagcatggtgtcggatgcgacgcgagcgccttatccgacctac	Protospacer
  **    *. ***********.**.********************

42. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.783

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
tctgagcatggtgtcggatgcgacgcgagcgccttatccgacctac	Protospacer
  **    *. ***********.**.********************

43. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.783

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
tctgagcatggtgtcggatgcgacgcgagcgccttatccgacctac	Protospacer
  **    *. ***********.**.********************

44. spacer 4.1|3338155|46|CP027390|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.783

aatgctgttattgtcggatgcggcgtgagcgccttatccgacctac	CRISPR spacer
tctgagcatggtgtcggatgcgacgcgagcgccttatccgacctac	Protospacer
  **    *. ***********.**.********************

45. spacer 6.9|5086375|32|CP027390|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

gacgccgccgccgcgaagccgtttccgatgtt	CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc	Protospacer
    ******* *********.***** . *.

46. spacer 7.3|5112288|32|CP027390|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688

gaaactgaatcatcattgattacccgcgaaga	CRISPR spacer
tgggctgcatcatcattgattacctgcaactg	Protospacer
 ...*** ****************.**.*  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage