1. spacer 1.1|541384|40|CP027442|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 2.1|2284097|32|CP027442|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
aaaaccaaacttctccataaattccatagccg CRISPR spacer
attactaaacttctgcataaattccataggag Protospacer
* **.******** ************** *
3. spacer 3.1|2310071|32|CP027442|CRISPRCasFinder matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc Protospacer
*** . * .****** ******** *******
4. spacer 3.1|2310071|32|CP027442|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac Protospacer
..* .***** **** ************* *
5. spacer 3.2|2310132|32|CP027442|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75
-gacagaacggcctcagtagtctcgtcaggctc CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt Protospacer
** * .****.******.***********.
6. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggtgctgtcgggagcggggaggatgagagaat Protospacer
. *.******* *** ***********...**
7. spacer 3.1|2310071|32|CP027442|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc Protospacer
*. ..****** ************** **
8. spacer 3.4|2310254|32|CP027442|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcatagccaggctgatccggcgacggcctta CRISPR spacer
gcagcagaccggctgatccggcgacggccccg Protospacer
* ..** * *******************...
9. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
10. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
11. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
12. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
13. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
14. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
15. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
16. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
17. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
18. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
19. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
20. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
21. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
22. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
23. spacer 3.9|2310559|32|CP027442|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
24. spacer 2.3|2284219|32|CP027442|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
caaaatattacgagcttcgtcaggccatggac CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgc Protospacer
. ..**.*************** **** .*
25. spacer 3.1|2310071|32|CP027442|CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa Protospacer
.* . *****.********* *******
26. spacer 3.19|2310070|34|CP027442|PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706
tcaacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggggctgtggaaagggctgcgcggcggcggcgac Protospacer
..* .***** **** ************* *
27. spacer 2.3|2284219|32|CP027442|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
caaaatattacgagcttcgtcaggccatggac CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgg Protospacer
. ..**.*************** **** .
28. spacer 3.19|2310070|34|CP027442|PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 11, identity: 0.676
tcaacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggcccgggaaaaacgggttcgcggcggcggcttc Protospacer
*. ..****** ************** **
29. spacer 3.22|2310253|34|CP027442|PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
tcggcatagccaggctgatccggcgacggcctta CRISPR spacer
gagcagcagaccggctgatccggcgacggccccg Protospacer
* ..** * *******************...
