Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027445 Escherichia coli strain 2013C-3492 chromosome, complete genome 9 crisprs NA 0 5 0 0
CP027446 Escherichia coli strain 2013C-3492 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027445
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_1 947528-947619 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_2 1230255-1230403 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_3 2108261-2108376 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_4 2131288-2131420 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_5 2366447-2366559 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_6 3654561-3654681 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_7 4073796-4073879 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_8 4100293-4100383 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027445_9 4869789-4869925 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027445_4 4.1|2131305|42|CP027445|PILER-CR 2131305-2131346 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027445_1 1.1|947554|40|CP027445|CRISPRCasFinder 947554-947593 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027445_3 3.1|2108292|54|CP027445|CRISPRCasFinder 2108292-2108345 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP027445_4 4.2|2131364|40|CP027445|PILER-CR 2131364-2131403 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
CP027445_5 5.1|2366475|57|CP027445|CRISPRCasFinder 2366475-2366531 57 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15004-15060 11 0.807
CP027445_3 3.1|2108292|54|CP027445|CRISPRCasFinder 2108292-2108345 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
CP027445_5 5.1|2366475|57|CP027445|CRISPRCasFinder 2366475-2366531 57 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12104-12160 13 0.772
CP027445_5 5.1|2366475|57|CP027445|CRISPRCasFinder 2366475-2366531 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3364-3420 15 0.737
CP027445_5 5.1|2366475|57|CP027445|CRISPRCasFinder 2366475-2366531 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3363-3419 15 0.737
CP027445_5 5.1|2366475|57|CP027445|CRISPRCasFinder 2366475-2366531 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3363-3419 15 0.737
CP027445_5 5.1|2366475|57|CP027445|CRISPRCasFinder 2366475-2366531 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3363-3419 15 0.737

1. spacer 4.1|2131305|42|CP027445|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 1.1|947554|40|CP027445|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

3. spacer 3.1|2108292|54|CP027445|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
***************************************************** 

4. spacer 4.2|2131364|40|CP027445|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975

catggcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *****************************

5. spacer 5.1|2366475|57|CP027445|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 11, identity: 0.807

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggcaatgctgttattgt-	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggc-acctggtaattgtt	Protospacer
.*..********* ************* *************** *. . ** ***** 

6. spacer 3.1|2108292|54|CP027445|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** * 

7. spacer 5.1|2366475|57|CP027445|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.772

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggcaatgctgttattgt---	CRISPR spacer
gcgactcgtaggcctgataagacgcgccagcgtcgcatcaggcaccg-----aacgtcgg	Protospacer
  .************************ **************** .*     * .**   

8. spacer 5.1|2366475|57|CP027445|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 15, identity: 0.737

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*   

9. spacer 5.1|2366475|57|CP027445|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 15, identity: 0.737

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*   

10. spacer 5.1|2366475|57|CP027445|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 15, identity: 0.737

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*   

11. spacer 5.1|2366475|57|CP027445|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 15, identity: 0.737

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage