1. spacer 3.1|2900258|32|CP027371|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906
taagtgatatccatcatcgcatccagtgcgcc CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc Protospacer
.*******.*********************.*
2. spacer 4.6|2926839|32|CP027371|CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.875
caagccgggatttgctttcggccagttggtct CRISPR spacer
cagaccgggatttgctttcggccagtttgcct Protospacer
**..*********************** *.**
3. spacer 2.1|2198842|58|CP027371|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 5, identity: 0.914
agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattcag CRISPR spacer
agacccgagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgatcgt Protospacer
*********************** ****************************. **.
4. spacer 4.3|2926656|32|CP027371|CRISPRCasFinder matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 5, identity: 0.844
agagaacgcggcactgatccacatcgcgtacg CRISPR spacer
gtggaacgccgcactgatccacatcgcgtagg Protospacer
. .****** ******************** *
5. spacer 4.3|2926656|32|CP027371|CRISPRCasFinder matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 5, identity: 0.844
agagaacgcggcactgatccacatcgcgtacg CRISPR spacer
gtggaacgccgcactgatccacatcgcgtagg Protospacer
. .****** ******************** *
6. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034578 (Lactococcus lactis subsp. lactis strain UC08 plasmid pUC08E, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
7. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017930 (Lactobacillus sakei subsp. sakei DSM 20017 = JCM 1157 strain LT-13 plasmid pLs13-a, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
8. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043525 (Lactococcus lactis subsp. lactis bv. diacetylactis strain SD96 plasmid pSD96_01, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
9. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014889 (Lactobacillus backii strain TMW 1.1991 plasmid pL11991-8, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
10. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NC_015860 (Lactococcus lactis subsp. lactis plasmid pIL1, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
11. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP022342 (Enterococcus faecium strain KUHS13 plasmid pKO1, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
12. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044372 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-4, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
13. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG674581 (Enterococcus faecium strain HL1 plasmid pHLSA, complete sequence) position: , mismatch: 6, identity: 0.812
-tgaatctaaatgttttccaatctatttttttg CRISPR spacer
attcatc-aaattttttccaatttattttttta Protospacer
* *** **** *********.*********.
14. spacer 3.8|2900685|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041426 (Escherichia coli strain STEC388 plasmid pSTEC388_1, complete sequence) position: , mismatch: 6, identity: 0.812
tttatcgtcgcatgaatcgcggtatccatatt CRISPR spacer
ctggttgtcacatgaatcacggtatccatatt Protospacer
.* .*.***.********.*************
15. spacer 4.3|2926656|32|CP027371|CRISPRCasFinder matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 6, identity: 0.812
agagaacgcggcactgatccacatcgcgtacg CRISPR spacer
gtggaatgcggcgctgatccacatcgcgtagg Protospacer
. .***.*****.***************** *
16. spacer 4.3|2926656|32|CP027371|CRISPRCasFinder matches to MT740739 (Ralstonia phage Gerry, complete genome) position: , mismatch: 6, identity: 0.812
agagaacgcggcactgatccacatcgcgtacg CRISPR spacer
gtggaatgcggcgctgatccacatcgcgtagg Protospacer
. .***.*****.***************** *
17. spacer 4.9|2926654|34|CP027371|CRT matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 6, identity: 0.824
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaacgccgcactgatccacatcgcgtagg Protospacer
* . .****** ******************** *
18. spacer 4.9|2926654|34|CP027371|CRT matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 6, identity: 0.824
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaacgccgcactgatccacatcgcgtagg Protospacer
* . .****** ******************** *
19. spacer 4.15|2926655|34|CP027371|PILER-CR matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 6, identity: 0.824
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaacgccgcactgatccacatcgcgtagg Protospacer
* . .****** ******************** *
20. spacer 4.15|2926655|34|CP027371|PILER-CR matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 6, identity: 0.824
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaacgccgcactgatccacatcgcgtagg Protospacer
* . .****** ******************** *
21. spacer 1.4|878226|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032893 (Enterobacter kobei strain WCHEK045523 plasmid p1_045523, complete sequence) position: , mismatch: 7, identity: 0.781
tgccagatatttcagatcatgaacggttgcgc CRISPR spacer
agccagatatttcagatcataaatggtcgaag Protospacer
*******************.**.***.* .
22. spacer 3.1|2900258|32|CP027371|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781
taagtgat-atccatcatcgcatccagtgcgcc CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc Protospacer
.. **** .*** ******** **********
23. spacer 3.2|2900319|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NC_030948 (Ralstonia phage RSP15 DNA, complete genome) position: , mismatch: 7, identity: 0.781
tgcaaaacaaaactgtattgatcgcgttttgt CRISPR spacer
tgaagaacaaaactgtattgatcttctttcgg Protospacer
** *.****************** . ***.*
24. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to CP022460 (Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
catcgaccgcgccagcgccagtgcggcgcggt Protospacer
... ****.*********************.
25. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015232 (Epibacterium mobile F1926 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
ccgagaccgtgccagcgcctttgcggcgcgcc Protospacer
. * ************** ********* *
26. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR027555 (Epibacterium mobile isolate EPIB1 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
ccgagaccgtgccagcgcctttgcggcgcgcc Protospacer
. * ************** ********* *
27. spacer 4.1|2926534|32|CP027371|CRISPRCasFinder matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc Protospacer
*** . * .****** ******** *******
28. spacer 4.9|2926654|34|CP027371|CRT matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 7, identity: 0.794
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaatgcggcgctgatccacatcgcgtagg Protospacer
* . .***.*****.***************** *
29. spacer 4.9|2926654|34|CP027371|CRT matches to MT740739 (Ralstonia phage Gerry, complete genome) position: , mismatch: 7, identity: 0.794
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaatgcggcgctgatccacatcgcgtagg Protospacer
* . .***.*****.***************** *
30. spacer 4.15|2926655|34|CP027371|PILER-CR matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 7, identity: 0.794
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaatgcggcgctgatccacatcgcgtagg Protospacer
* . .***.*****.***************** *
31. spacer 4.15|2926655|34|CP027371|PILER-CR matches to MT740739 (Ralstonia phage Gerry, complete genome) position: , mismatch: 7, identity: 0.794
acagagaacgcggcactgatccacatcgcgtacg CRISPR spacer
aggtggaatgcggcgctgatccacatcgcgtagg Protospacer
* . .***.*****.***************** *
32. spacer 1.2|878106|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NC_021067 (Vibrio phage helene 12B3 genomic sequence) position: , mismatch: 8, identity: 0.75
cggcagaaaaaccggtcgcgctaatggagaaa CRISPR spacer
caacccaaaaaccagtcgctctaatggagtac Protospacer
*..* *******.***** ********* *
33. spacer 1.6|878346|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75
gtcatcggtatcgtcacgcgcaagggattcaa-- CRISPR spacer
ctcatcggtgtcgtcacgagcaa--gatcgcacc Protospacer
********.******** **** ***. *
34. spacer 1.8|878466|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.75
aatcgtagggcacacccttacggcagttaaaa CRISPR spacer
catgatagggcacaccattacggtagtttgga Protospacer
** .*********** ******.**** ..*
35. spacer 1.12|878706|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacgcgatccgggcgattcgggagttttcg CRISPR spacer
cggcggcgatccgggcgattcggaggttcacg Protospacer
.*. ******************..***. **
36. spacer 1.13|878766|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.75
ttcaccgagtgggtgctcgtgctgaatgaact CRISPR spacer
ctcaccgagtaggtgctggtgctgagagtgcc Protospacer
.*********.****** *******. * .*.
37. spacer 3.1|2900258|32|CP027371|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
taagtg---atatccatcatcgcatccagtgcgcc CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc Protospacer
*** . *******.*** ***********
38. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 8, identity: 0.75
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
cacgaacagtgtcagcgccagtgcggcgacgc Protospacer
..*. ** ***.**************** **
39. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to MK064565 (Sulfolobales Beppu rod-shaped virus 1 clone D, complete genome) position: , mismatch: 8, identity: 0.75
---tgaatctaaatgttttccaatctatttttttg CRISPR spacer
aattaaa---aaatgttttccagtctcttttttgt Protospacer
*.** ************.*** ******
40. spacer 3.9|2900746|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 8, identity: 0.75
gtccatcattgccttgttgatatacacaacgc CRISPR spacer
atcgcatactgccttgttggtatagacaacgc Protospacer
.** .*.**********.**** *******
41. spacer 4.1|2926534|32|CP027371|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac Protospacer
..* .***** **** ************* *
42. spacer 1.2|878106|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.719
cggcagaaaaaccggtcgcgctaatggagaaa CRISPR spacer
tgcgccaaaaaccgggcgcgcgaatggagatt Protospacer
.* ********* ***** ********
43. spacer 1.11|878646|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045307 (Legionella longbeachae strain B41211CHC plasmid pB41211CHC_76k, complete sequence) position: , mismatch: 9, identity: 0.719
tggcatgcaatcactacagctattaatttcta CRISPR spacer
gtaaaagacatcaatacaactattaatttcta Protospacer
. * * **** ****.*************
44. spacer 1.12|878706|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016485 (Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacgcgatccgggcgattcgg-----gagttttcg CRISPR spacer
tgatcgcgatccgggcgatccggccaatggat----- Protospacer
*** ***************.*** *..*
45. spacer 3.1|2900258|32|CP027371|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
taagtgatatccatcatcgcatccagtgcgcc CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc Protospacer
. .* ..*********** ***********
46. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010647 (Phaeobacter piscinae strain P36 plasmid pP36_d, complete sequence) position: , mismatch: 9, identity: 0.719
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
cttgcagcctgccagcgccagggcggcgcagc Protospacer
. ...* * ************ *******.**
47. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LN907828 (Erwinia gerundensis isolate E_g_EM595 plasmid pEM01, complete sequence) position: , mismatch: 9, identity: 0.719
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
tacgcctgctgccagcgccagtgctgcgccgc Protospacer
*.*.. . *************** **** **
48. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013682 (Clostridium botulinum strain 1169 plasmid pRSJ8_1, complete sequence) position: , mismatch: 9, identity: 0.719
tgaatctaaatgttttccaatctatttttttg CRISPR spacer
gtcttctaaatgttttataatctattttatct Protospacer
************ .********** *.
49. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013295 (Clostridium botulinum strain CDC_54064 plasmid pNPD1_1, complete sequence) position: , mismatch: 9, identity: 0.719
tgaatctaaatgttttccaatctatttttttg CRISPR spacer
gtcttctaaatgttttataatctattttatct Protospacer
************ .********** *.
50. spacer 3.7|2900624|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to MN694366 (Marine virus AFVG_250M1050, complete genome) position: , mismatch: 9, identity: 0.719
tgaatctaaatgttttccaatctatttttttg CRISPR spacer
ttgccttttatgtgttcaaatctatttttttg Protospacer
* . ..* **** *** **************
51. spacer 4.1|2926534|32|CP027371|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc Protospacer
*. ..****** ************** **
52. spacer 4.6|2926839|32|CP027371|CRISPRCasFinder matches to MK448935 (Streptococcus phage Javan424, complete genome) position: , mismatch: 9, identity: 0.719
caagccgggatttgctttcggccagttggtct CRISPR spacer
aagtgagggattagctttcagccagttggctt Protospacer
*. ****** ******.*********..*
53. spacer 4.6|2926839|32|CP027371|CRISPRCasFinder matches to MK448936 (Streptococcus phage Javan426, complete genome) position: , mismatch: 9, identity: 0.719
caagccgggatttgctttcggccagttggtct CRISPR spacer
aagtgagggattagctttcagccagttggctt Protospacer
*. ****** ******.*********..*
54. spacer 1.13|878766|32|CP027371|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 10, identity: 0.688
ttcaccgagtgggtgctcgtgctgaatgaact CRISPR spacer
ctcacggagtgggtgctcgggctgtcgggggc Protospacer
.**** ************* **** *.. .
55. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 10, identity: 0.688
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
ctcgctgcgtgccaccgccagttcggcgcgca Protospacer
. *.. ******* ******* *******
56. spacer 3.5|2900502|32|CP027371|CRT,PILER-CR,CRISPRCasFinder matches to NC_015724 (Cupriavidus necator N-1 plasmid pBB2, complete sequence) position: , mismatch: 10, identity: 0.688
tgcataccgtgccagcgccagtgcggcgcggc CRISPR spacer
ctcgctgcgtgccaccgccagttcggcgcgca Protospacer
. *.. ******* ******* *******
57. spacer 4.1|2926534|32|CP027371|CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa Protospacer
.* . *****.********* *******
58. spacer 4.4|2926717|32|CP027371|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 10, identity: 0.688
tcagccaagttttgcgcccggcgcaagtagcg CRISPR spacer
cccaccaagctttgcgccaggcgcaagcgcaa Protospacer
.* .*****.******** ********.. .
59. spacer 4.7|2926532|34|CP027371|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706
tcaacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggggctgtggaaagggctgcgcggcggcggcgac Protospacer
..* .***** **** ************* *
60. spacer 4.13|2926533|34|CP027371|PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706
tcaacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggggctgtggaaagggctgcgcggcggcggcgac Protospacer
..* .***** **** ************* *
61. spacer 2.1|2198842|58|CP027371|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.81
---agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattca CRISPR spacer
acaaaact---gcactcaaccgtaggccggataaggcgttcacgccgcatccggcaattg Protospacer
*.**. **** *************************************** *..
62. spacer 2.1|2198842|58|CP027371|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.81
---agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattca CRISPR spacer
acaaaact---gcactcaaccgtaggccggataaggcgttcacgccgcatccggcaattg Protospacer
*.**. **** *************************************** *..
63. spacer 4.7|2926532|34|CP027371|CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 11, identity: 0.676
tcaacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggcccgggaaaaacgggttcgcggcggcggcttc Protospacer
*. ..****** ************** **
64. spacer 4.13|2926533|34|CP027371|PILER-CR matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 11, identity: 0.676
tcaacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggcccgggaaaaacgggttcgcggcggcggcttc Protospacer
*. ..****** ************** **
