Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027437 Escherichia coli strain 2012C-4221 chromosome, complete genome 3 crisprs NA 0 7 0 0
CP027438 Escherichia coli strain 2012C-4221 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP027439 Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027437
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027437_1 380297-380420 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027437_2 1099439-1099530 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027437_3 4106130-4106402 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027437_2 2.1|1099465|40|CP027437|CRISPRCasFinder 1099465-1099504 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027437_1 1.1|380340|38|CP027437|CRISPRCasFinder 380340-380377 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027437_3 3.5|4106159|32|CP027437|CRISPRCasFinder,CRT 4106159-4106190 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224872-224903 7 0.781
CP027437_3 3.1|4106157|34|CP027437|PILER-CR 4106157-4106190 34 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224872-224905 8 0.765
CP027437_3 3.6|4106220|32|CP027437|CRISPRCasFinder,CRT 4106220-4106251 32 MN693555 Marine virus AFVG_25M96, complete genome 25577-25608 9 0.719
CP027437_3 3.6|4106220|32|CP027437|CRISPRCasFinder,CRT 4106220-4106251 32 LC168164 Tenacibaculum phage pT24 DNA, complete genome 13744-13775 10 0.688
CP027437_3 3.8|4106342|32|CP027437|CRISPRCasFinder,CRT 4106342-4106373 32 NZ_CP029549 Lactobacillus paracasei strain EG9 plasmid pEG9C, complete sequence 3165-3196 10 0.688
CP027437_3 3.8|4106342|32|CP027437|CRISPRCasFinder,CRT 4106342-4106373 32 NZ_AP012543 Lactobacillus paracasei subsp. paracasei JCM 8130 plasmid pLBPC-2, complete sequence 9203-9234 10 0.688
CP027437_3 3.2|4106218|34|CP027437|PILER-CR 4106218-4106251 34 MN693555 Marine virus AFVG_25M96, complete genome 25577-25610 11 0.676
CP027437_3 3.2|4106218|34|CP027437|PILER-CR 4106218-4106251 34 LC168164 Tenacibaculum phage pT24 DNA, complete genome 13744-13777 12 0.647

1. spacer 2.1|1099465|40|CP027437|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcatttttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.************************

2. spacer 1.1|380340|38|CP027437|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 3.5|4106159|32|CP027437|CRISPRCasFinder,CRT matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

gccgtcgccggatcagcctggcta-tgccagca	CRISPR spacer
gccgtcgccggatcagccggtctgctgctcgg-	Protospacer
****************** * **. ***. *

4. spacer 3.1|4106157|34|CP027437|PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765 

cggccgtcgccggatcagcctggcta-tgccagca	CRISPR spacer
gggccgtcgccggatcagccggtctgctgctcgg-	Protospacer
 ******************* * **. ***. *

5. spacer 3.6|4106220|32|CP027437|CRISPRCasFinder,CRT matches to MN693555 (Marine virus AFVG_25M96, complete genome) position: , mismatch: 9, identity: 0.719 

gacgaacaaaataaaaaccaactgaatgatgc	CRISPR spacer
agagaacaaaataaaaaccaatttaattacag	Protospacer
.. ******************.* *** *..

6. spacer 3.6|4106220|32|CP027437|CRISPRCasFinder,CRT matches to LC168164 (Tenacibaculum phage pT24 DNA, complete genome) position: , mismatch: 10, identity: 0.688 

gacgaacaaaataaaaaccaactgaatgatgc	CRISPR spacer
ctttaacaaaataaaaacccaccgaatgggtg	Protospacer
  . *************** **.*****.

7. spacer 3.8|4106342|32|CP027437|CRISPRCasFinder,CRT matches to NZ_CP029549 (Lactobacillus paracasei strain EG9 plasmid pEG9C, complete sequence) position: , mismatch: 10, identity: 0.688 

gataggtgttacacatatgacctggcactggc	CRISPR spacer
agttcctgttacaaatattacctggcacttat	Protospacer
..*   ******* **** ********** ..

8. spacer 3.8|4106342|32|CP027437|CRISPRCasFinder,CRT matches to NZ_AP012543 (Lactobacillus paracasei subsp. paracasei JCM 8130 plasmid pLBPC-2, complete sequence) position: , mismatch: 10, identity: 0.688 

gataggtgttacacatatgacctggcactggc	CRISPR spacer
agttcctgttacaaatattacctggcacttat	Protospacer
..*   ******* **** ********** ..

9. spacer 3.2|4106218|34|CP027437|PILER-CR matches to MN693555 (Marine virus AFVG_25M96, complete genome) position: , mismatch: 11, identity: 0.676 

cggacgaacaaaataaaaaccaactgaatgatgc	CRISPR spacer
atagagaacaaaataaaaaccaatttaattacag	Protospacer
  .. ******************.* *** *..

10. spacer 3.2|4106218|34|CP027437|PILER-CR matches to LC168164 (Tenacibaculum phage pT24 DNA, complete genome) position: , mismatch: 12, identity: 0.647 

cggacgaacaaaataaaaaccaactgaatgatgc	CRISPR spacer
ttctttaacaaaataaaaacccaccgaatgggtg	Protospacer
.   . *************** **.*****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage