Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027441 Escherichia coli strain 2012C-4502 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP027440 Escherichia coli strain 2012C-4502 chromosome, complete genome 6 crisprs NA 0 20 0 0

Results visualization

1. CP027440
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027440_1 645367-645497 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027440_2 1842366-1843188 Orphan I-E
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027440_3 1868736-1869069 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027440_4 2845241-2845391 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027440_5 3138991-3139117 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027440_6 4029162-4029306 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027440_1 1.1|645408|49|CP027440|CRISPRCasFinder 645408-645456 49 KJ603229 Shigella phage POCJ13, complete genome 10125-10173 0 1.0
CP027440_1 1.1|645408|49|CP027440|CRISPRCasFinder 645408-645456 49 NC_029120 Shigella phage 75/02 Stx, complete genome 10125-10173 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_KX880944 Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence 88542-88573 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP045829 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence 90378-90409 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP035549 Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_89, complete sequence 7384-7415 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP042632 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence 57405-57436 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP019188 Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence 43594-43625 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP034163 Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence 3260-3291 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP026725 Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence 88488-88519 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP021729 Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence 70436-70467 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MN232192 Escherichia coli plasmid pGD27-62, complete sequence 19837-19868 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP028585 Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence 49869-49900 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP009051 Escherichia coli NCCP15648 plasmid p15648-1, complete sequence 67414-67445 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP030183 Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence 85851-85882 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP032875 Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence 65145-65176 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP038378 Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence 78942-78973 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 22447-22478 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 81471-81502 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 17922-17953 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP022733 Escherichia coli strain SA186 plasmid pSA186_4, complete sequence 78767-78798 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP022228 Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence 13572-13603 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_AP018809 Escherichia coli strain E2865 plasmid pE2865-1, complete sequence 66910-66941 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 125935-125966 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 41269-41300 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP021537 Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence 2067-2098 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP023732 Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence 34543-34574 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 CP050999 Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_2 24626-24657 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP011430 Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_89, complete sequence 82896-82927 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP032492 Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_91, complete sequence 7384-7415 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP032497 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_75, complete sequence 68676-68707 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 42832-42863 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP013030 Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence 76592-76623 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MF510496 Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence 19837-19868 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP029365 Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence 49700-49731 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP030784 Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence 15911-15942 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP052881 Escherichia coli strain C21 plasmid pC21-4, complete sequence 85201-85232 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP034164 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence 54502-54533 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP020051 Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence 76673-76704 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP028125 Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence 13589-13620 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP026938 Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence 74353-74384 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 64291-64322 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 103144-103175 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_LT985263 Escherichia coli strain 511 plasmid RCS54_p, complete sequence 111845-111876 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MN101851 Escherichia coli strain 13ZX28 plasmid p13ZX28-90, complete sequence 12180-12211 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MN101855 Escherichia coli strain 13ZX36 plasmid p13ZX36-90, complete sequence 12187-12218 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 67784-67815 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MH580301 Escherichia coli strain 1107 plasmid p1107-99K, complete sequence 13729-13760 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MG825379 Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence 86134-86165 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MG288678 Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence 87052-87083 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP038288 Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence 89299-89330 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MH160767 Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome 63444-63475 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_042128 Escherichia phage RCS47, complete genome 78471-78502 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_031129 Salmonella phage SJ46, complete genome 98253-98284 0 1.0
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MF356679 Escherichia phage D6, complete genome 6021-6052 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_KX880944 Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence 88542-88573 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP045829 Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence 90378-90409 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP035549 Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_89, complete sequence 7384-7415 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP042632 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence 57405-57436 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP019188 Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence 43594-43625 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP034163 Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence 3260-3291 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP026725 Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence 88488-88519 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP021729 Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence 70436-70467 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MN232192 Escherichia coli plasmid pGD27-62, complete sequence 19837-19868 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP028585 Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence 49869-49900 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP009051 Escherichia coli NCCP15648 plasmid p15648-1, complete sequence 67414-67445 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP030183 Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence 85851-85882 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP032875 Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence 65145-65176 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP038378 Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence 78942-78973 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 22447-22478 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 81471-81502 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 17922-17953 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP022733 Escherichia coli strain SA186 plasmid pSA186_4, complete sequence 78767-78798 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP022228 Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence 13572-13603 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_AP018809 Escherichia coli strain E2865 plasmid pE2865-1, complete sequence 66910-66941 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP021720 Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence 125935-125966 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 41269-41300 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP021537 Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence 2067-2098 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP023732 Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence 34543-34574 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 CP050999 Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_2 24626-24657 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP011430 Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_89, complete sequence 82896-82927 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP032492 Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_91, complete sequence 7384-7415 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP032497 Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_75, complete sequence 68676-68707 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 42832-42863 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP013030 Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence 76592-76623 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MF510496 Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence 19837-19868 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP029365 Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence 49700-49731 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP030784 Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence 15911-15942 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP052881 Escherichia coli strain C21 plasmid pC21-4, complete sequence 85201-85232 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP034164 Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence 54502-54533 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP020051 Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence 76673-76704 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP028125 Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence 13589-13620 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP026938 Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence 74353-74384 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 64291-64322 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 103144-103175 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_LT985263 Escherichia coli strain 511 plasmid RCS54_p, complete sequence 111845-111876 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MN101851 Escherichia coli strain 13ZX28 plasmid p13ZX28-90, complete sequence 12180-12211 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MN101855 Escherichia coli strain 13ZX36 plasmid p13ZX36-90, complete sequence 12187-12218 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 67784-67815 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MH580301 Escherichia coli strain 1107 plasmid p1107-99K, complete sequence 13729-13760 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MG825379 Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence 86134-86165 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MG288678 Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence 87052-87083 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP038288 Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence 89299-89330 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MH160767 Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome 63444-63475 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_042128 Escherichia phage RCS47, complete genome 78471-78502 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_031129 Salmonella phage SJ46, complete genome 98253-98284 0 1.0
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MF356679 Escherichia phage D6, complete genome 6021-6052 0 1.0
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11833-11866 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36518-36551 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9504-9537 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65532-65565 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64163-64196 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119282-119315 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85097-85130 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42114-42147 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87235-87268 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70498-70531 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62995-63028 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 MH422554 Escherichia phage P1, complete genome 87192-87225 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NC_050152 Enterobacteria phage P7, complete genome 93993-94026 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58643-58676 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 MH445381 Escherichia virus P1, complete genome 56868-56901 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42180 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1590 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94789 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61949 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20319 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46721 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81886 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47894 1 0.971
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NC_031129 Salmonella phage SJ46, complete genome 77363-77396 1 0.971
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_050152 Enterobacteria phage P7, complete genome 73422-73453 1 0.969
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 LT906557 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II 80218-80249 1 0.969
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP027309 Escherichia coli strain 2015C-3108 plasmid unnamed2, complete sequence 16615-16646 1 0.969
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP047663 Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence 77902-77933 1 0.969
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP034790 Escherichia coli strain ECCNB20-2 plasmid pTB423, complete sequence 44070-44101 1 0.969
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MK356558 Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence 111801-111832 1 0.969
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_050152 Enterobacteria phage P7, complete genome 73422-73453 1 0.969
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 LT906557 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II 80218-80249 1 0.969
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP027309 Escherichia coli strain 2015C-3108 plasmid unnamed2, complete sequence 16615-16646 1 0.969
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP047663 Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence 77902-77933 1 0.969
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP034790 Escherichia coli strain ECCNB20-2 plasmid pTB423, complete sequence 44070-44101 1 0.969
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MK356558 Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence 111801-111832 1 0.969
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
CP027440_2 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder 1842395-1842426 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 82293-82324 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 70951-70982 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 69096-69127 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_KU980950 Escherichia coli strain WE-0250 plasmid U2501, complete sequence 41003-41034 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 89017-89048 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP010146 Escherichia coli strain D5 plasmid A, complete genome 70643-70674 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 CP054337 Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence 34431-34462 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP043218 Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence 93587-93618 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP010173 Escherichia coli strain H8 plasmid A, complete sequence 48102-48133 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_LT905089 Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1 72281-72312 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP034959 Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence 81612-81643 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP020522 Escherichia coli strain 190 plasmid unnamed3, complete sequence 47984-48015 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP019281 Escherichia coli strain 13P484A plasmid p13P484A-1, complete sequence 27359-27390 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP047090 Salmonella sp. S13 plasmid pS13-1, complete sequence 10868-10899 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_LR130557 Escherichia coli strain MS14385 isolate MS14385 plasmid 3 103455-103486 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP015997 Escherichia coli strain S51 plasmid pS51_2, complete sequence 57198-57229 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 17008-17039 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP041960 Escherichia coli strain EC2 plasmid pEC2_5, complete sequence 88693-88724 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP027133 Escherichia coli strain AR_0372 plasmid unnamed4 53082-53113 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 3111-3142 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 95097-95128 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP039843 Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1 35357-35388 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 65340-65371 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP035313 Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence 50352-50383 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP021203 Escherichia coli strain Z1002 plasmid p1002-1, complete sequence 73752-73783 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP029103 Escherichia coli strain AR437 plasmid unnamed1, complete sequence 21943-21974 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 94279-94310 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 84507-84538 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 CP043746 Escherichia coli strain CVM N16EC0879 plasmid pN16EC0879-2, complete sequence 1090-1121 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 47126-47157 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP031232 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence 8597-8628 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP023896 Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence 19963-19994 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP009168 Escherichia coli 1303 plasmid p1303_95, complete sequence 85600-85631 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 47204-47235 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP023381 Escherichia coli strain 127 plasmid p91, complete sequence 81741-81772 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP040069 Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence 88119-88150 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 40858-40889 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 62224-62255 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 79080-79111 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_017653 Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence 67645-67676 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 57777-57808 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP019054 Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence 27032-27063 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 48030-48061 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP041630 Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence 84158-84189 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP041922 Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence 77486-77517 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 34856-34887 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 69882-69913 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP033882 Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence 52992-53023 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 63997-64028 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 20262-20293 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP016549 Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence 56888-56919 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP031654 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence 80413-80444 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MK419152 Escherichia coli strain D72C plasmid pD72C, complete sequence 93286-93317 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MK410117 Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence 85953-85984 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MK455768 Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence 85935-85966 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 51403-51434 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MH844525 Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence 23960-23991 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_MK256965 Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence 101272-101303 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 39803-39834 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 70593-70624 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NZ_CP027199 Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence 86680-86711 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 AF234173 Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome 70721-70752 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MH422554 Escherichia phage P1, complete genome 65017-65048 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_005856 Enterobacteria phage P1, complete genome 71040-71071 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 AP012536 Stx2-converting phage Stx2a_1447 proviral DNA, complete genome 5742-5773 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 JQ182728 Enterobacteria phage mEp460, complete genome 31302-31333 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 36468-36499 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 KF030445 Escherichia phage 1720a-02, complete genome 40185-40216 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MF807953 Escherichia phage Ayreon, complete genome 32798-32829 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_049941 Stx2-converting phage Stx2a_WGPS2 proviral DNA, complete genome 5742-5773 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 NC_009514 Phage cdtI DNA, complete genome 34393-34424 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MH445381 Escherichia virus P1, complete genome 34693-34724 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 LR595862 Escherichia virus Lambda_2H10 genome assembly, chromosome: 1 33057-33088 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 AF234172 Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome 71040-71071 2 0.938
CP027440_3 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT 1868887-1868918 32 MK356558 Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence 22383-22414 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 82293-82324 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 70951-70982 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MF679145 Escherichia coli plasmid pBJ114-96, complete sequence 69096-69127 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_KU980950 Escherichia coli strain WE-0250 plasmid U2501, complete sequence 41003-41034 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 89017-89048 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP010146 Escherichia coli strain D5 plasmid A, complete genome 70643-70674 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 CP054337 Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence 34431-34462 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP043218 Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence 93587-93618 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP010173 Escherichia coli strain H8 plasmid A, complete sequence 48102-48133 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_LT905089 Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1 72281-72312 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP034959 Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence 81612-81643 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP020522 Escherichia coli strain 190 plasmid unnamed3, complete sequence 47984-48015 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP019281 Escherichia coli strain 13P484A plasmid p13P484A-1, complete sequence 27359-27390 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP047090 Salmonella sp. S13 plasmid pS13-1, complete sequence 10868-10899 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_LR130557 Escherichia coli strain MS14385 isolate MS14385 plasmid 3 103455-103486 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP015997 Escherichia coli strain S51 plasmid pS51_2, complete sequence 57198-57229 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 17008-17039 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP041960 Escherichia coli strain EC2 plasmid pEC2_5, complete sequence 88693-88724 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP027133 Escherichia coli strain AR_0372 plasmid unnamed4 53082-53113 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP040920 Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence 3111-3142 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 95097-95128 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP039843 Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1 35357-35388 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP024832 Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence 65340-65371 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP035313 Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence 50352-50383 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP021203 Escherichia coli strain Z1002 plasmid p1002-1, complete sequence 73752-73783 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP029103 Escherichia coli strain AR437 plasmid unnamed1, complete sequence 21943-21974 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP024817 Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence 94279-94310 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 84507-84538 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 CP043746 Escherichia coli strain CVM N16EC0879 plasmid pN16EC0879-2, complete sequence 1090-1121 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP029117 Escherichia coli strain AR435 plasmid unnamed4 47126-47157 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP031232 Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence 8597-8628 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP023896 Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence 19963-19994 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP009168 Escherichia coli 1303 plasmid p1303_95, complete sequence 85600-85631 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP023961 Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence 47204-47235 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP023381 Escherichia coli strain 127 plasmid p91, complete sequence 81741-81772 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP040069 Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence 88119-88150 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 40858-40889 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 AP023222 Escherichia coli M505 plasmid pM505-b DNA, complete genome 62224-62255 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 AP023233 Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome 79080-79111 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_017653 Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence 67645-67676 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 57777-57808 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP019054 Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence 27032-27063 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP019075 Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence 48030-48061 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP041630 Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence 84158-84189 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP041922 Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence 77486-77517 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP015837 Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence 34856-34887 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 69882-69913 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP033882 Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence 52992-53023 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP033848 Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence 63997-64028 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 20262-20293 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP016549 Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence 56888-56919 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP031654 Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence 80413-80444 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MK419152 Escherichia coli strain D72C plasmid pD72C, complete sequence 93286-93317 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MK410117 Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence 85953-85984 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MK455768 Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence 85935-85966 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 51403-51434 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MH844525 Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence 23960-23991 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_MK256965 Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence 101272-101303 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 39803-39834 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP011063 Escherichia coli str. Sanji plasmid pSJ_98, complete sequence 70593-70624 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NZ_CP027199 Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence 86680-86711 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 AF234173 Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome 70721-70752 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MH422554 Escherichia phage P1, complete genome 65017-65048 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_005856 Enterobacteria phage P1, complete genome 71040-71071 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 AP012536 Stx2-converting phage Stx2a_1447 proviral DNA, complete genome 5742-5773 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 JQ182728 Enterobacteria phage mEp460, complete genome 31302-31333 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 36468-36499 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 KF030445 Escherichia phage 1720a-02, complete genome 40185-40216 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MF807953 Escherichia phage Ayreon, complete genome 32798-32829 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_049941 Stx2-converting phage Stx2a_WGPS2 proviral DNA, complete genome 5742-5773 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 NC_009514 Phage cdtI DNA, complete genome 34393-34424 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MH445381 Escherichia virus P1, complete genome 34693-34724 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 LR595862 Escherichia virus Lambda_2H10 genome assembly, chromosome: 1 33057-33088 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 AF234172 Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome 71040-71071 2 0.938
CP027440_3 3.8|1868888|32|CP027440|PILER-CR 1868888-1868919 32 MK356558 Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence 22383-22414 2 0.938
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17438-17471 3 0.912
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122308-122341 3 0.912
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6027-6060 3 0.912
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131400-131433 3 0.912
CP027440_2 2.14|1842393|34|CP027440|CRT 1842393-1842426 34 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15154 3 0.912
CP027440_2 2.3|1842517|32|CP027440|PILER-CR,CRISPRCasFinder 1842517-1842548 32 NZ_CP011408 Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence 35508-35539 5 0.844
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 MT230402 Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence 271-327 5 0.912
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4005-4061 5 0.912
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4004-4060 5 0.912
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4004-4060 5 0.912
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4004-4060 5 0.912
CP027440_2 2.3|1842517|32|CP027440|PILER-CR,CRISPRCasFinder 1842517-1842548 32 NZ_CP054046 Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence 31692-31723 6 0.812
CP027440_2 2.16|1842515|34|CP027440|CRT 1842515-1842548 34 NZ_CP011408 Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence 35508-35541 6 0.824
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4106-4162 6 0.895
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4105-4161 6 0.895
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4105-4161 6 0.895
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4105-4161 6 0.895
CP027440_2 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder 1842456-1842487 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 897526-897557 7 0.781
CP027440_2 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder 1842456-1842487 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 585720-585751 7 0.781
CP027440_2 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder 1842456-1842487 32 NZ_CP021367 Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence 89866-89897 7 0.781
CP027440_2 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder 1842456-1842487 32 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 97239-97270 7 0.781
CP027440_2 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder 1842456-1842487 32 NZ_CP021363 Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence 75914-75945 7 0.781
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7384-7440 7 0.877
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84208-84264 7 0.877
CP027440_2 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder 1842456-1842487 32 NZ_CP011054 Halomonas sp. KO116 plasmid unnamed2, complete sequence 177867-177898 8 0.75
CP027440_2 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder 1842701-1842732 32 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 270828-270859 8 0.75
CP027440_2 2.16|1842515|34|CP027440|CRT 1842515-1842548 34 NZ_CP054046 Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence 31692-31725 8 0.765
CP027440_2 2.19|1842699|34|CP027440|CRT 1842699-1842732 34 JN638751 Bacillus phage G, complete genome 32050-32083 8 0.765
CP027440_2 2.4|1842578|32|CP027440|PILER-CR,CRISPRCasFinder 1842578-1842609 32 NC_010391 Salmonella phage Fels-1, complete genome 29011-29042 9 0.719
CP027440_2 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder 1842701-1842732 32 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 20705-20736 9 0.719
CP027440_2 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder 1842701-1842732 32 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 301437-301468 9 0.719
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP008935 Geobacillus stearothermophilus 10 plasmid unnamed, complete sequence 422-453 9 0.719
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026937 Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence 91244-91275 9 0.719
CP027440_2 2.15|1842454|34|CP027440|CRT 1842454-1842487 34 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 897526-897559 9 0.735
CP027440_2 2.15|1842454|34|CP027440|CRT 1842454-1842487 34 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 585718-585751 9 0.735
CP027440_2 2.15|1842454|34|CP027440|CRT 1842454-1842487 34 NZ_CP021367 Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence 89864-89897 9 0.735
CP027440_2 2.15|1842454|34|CP027440|CRT 1842454-1842487 34 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 97237-97270 9 0.735
CP027440_2 2.15|1842454|34|CP027440|CRT 1842454-1842487 34 NZ_CP021363 Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence 75912-75945 9 0.735
CP027440_3 3.5|1869009|32|CP027440|CRISPRCasFinder,CRT 1869009-1869040 32 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 292987-293018 9 0.719
CP027440_3 3.5|1869009|32|CP027440|CRISPRCasFinder,CRT 1869009-1869040 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 84317-84348 9 0.719
CP027440_3 3.5|1869009|32|CP027440|CRISPRCasFinder,CRT 1869009-1869040 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 606642-606673 9 0.719
CP027440_3 3.10|1869010|32|CP027440|PILER-CR 1869010-1869041 32 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 292987-293018 9 0.719
CP027440_3 3.10|1869010|32|CP027440|PILER-CR 1869010-1869041 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 84317-84348 9 0.719
CP027440_3 3.10|1869010|32|CP027440|PILER-CR 1869010-1869041 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 606642-606673 9 0.719
CP027440_2 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder 1842701-1842732 32 MK250021 Prevotella phage Lak-B2, complete genome 441159-441190 10 0.688
CP027440_2 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder 1842701-1842732 32 MK250023 Prevotella phage Lak-B4, complete genome 440369-440400 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026049 Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence 81077-81108 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018351 Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence 114733-114764 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018674 Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence 56066-56097 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP014073 Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence 61883-61914 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029493 Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence 137630-137661 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP034786 Escherichia coli strain ECZP248 plasmid pTB402, complete sequence 100297-100328 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP009414 Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence 66183-66214 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_KX458222 Klebsiella pneumoniae strain B2 plasmid pB2-1, complete sequence 63133-63164 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_KX960110 Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence 47931-47962 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_KU295131 Escherichia coli strain BK28009 plasmid pBK28009, complete sequence 56913-56944 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP038792 Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence 32138-32169 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP010130 Escherichia coli strain C9 plasmid A, complete genome 58636-58667 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP012988 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence 156629-156660 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044528 Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence 88895-88926 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 89908-89939 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP050844 Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence 205031-205062 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP013323 Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence 37224-37255 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025857 Escherichia coli strain 504838 plasmid p504838_108, complete sequence 103781-103812 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025858 Escherichia coli strain 504838 plasmid p504838_88, complete sequence 48869-48900 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025858 Escherichia coli strain 504838 plasmid p504838_88, complete sequence 62923-62954 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 22698-22729 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP050830 Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence 130216-130247 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052410 Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-3, complete sequence 3136-3167 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052450 Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP023417 Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence 64596-64627 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 40972-41003 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052491 Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence 185336-185367 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028805 Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence 3144-3175 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP012994 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence 72351-72382 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024194 Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed3, complete sequence 3112-3143 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 132117-132148 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_014107 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence 89666-89697 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052311 Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence 3120-3151 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN543585 Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence 21551-21582 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_010886 Klebsiella pneumoniae plasmid pK245, complete sequence 40277-40308 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP010179 Escherichia coli strain H15 plasmid A, complete genome 6625-6656 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052296 Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026804 Shigella flexneri strain 89-141 plasmid unnamed1 183889-183920 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026794 Shigella flexneri strain 74-1170 plasmid unnamed 163435-163466 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP033511 Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence 121697-121728 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 25532-25563 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 45087-45118 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 12118-12149 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042507 Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence 192208-192239 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_AP019010 Serratia marcescens strain AS-1 plasmid pSERAS01, complete sequence 8333-8364 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN543571 Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence 21550-21581 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 25531-25562 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026789 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed1, complete sequence 8095-8126 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 134450-134481 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026237 Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence 175696-175727 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 74299-74330 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026170 Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence 16236-16267 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP034059 Shigella flexneri strain FDAARGOS_535 plasmid unnamed1, complete sequence 39292-39323 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024476 Shigella flexneri 7b strain 94-3007 plasmid unnamed3, complete sequence 66681-66712 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024476 Shigella flexneri 7b strain 94-3007 plasmid unnamed3, complete sequence 199997-200028 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_LR213456 Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 2 170613-170644 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026771 Shigella flexneri Y strain 93-3063 plasmid unnamed3, complete sequence 114194-114225 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044157 Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence 72741-72772 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 65210-65241 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 56204-56235 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 43673-43704 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 114863-114894 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 119867-119898 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028955 Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence 74467-74498 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_023333 Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence 187492-187523 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029181 Escherichia coli strain H9Ecoli plasmid p1-H9, complete sequence 3888-3919 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN232190 Escherichia coli plasmid pGD27-31, complete sequence 152394-152425 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052405 Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence 115616-115647 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052137 Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP012138 Shigella flexneri 2a strain 981 plasmid 981p1, complete sequence 138218-138249 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044160 Shigella flexneri strain AR-0423 plasmid pAR-0423-2, complete sequence 6903-6934 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 LC556210 Enterobacter cloacae CC23 plasmid pCC23 DNA, complete sequence 168776-168807 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 134465-134496 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 75445-75476 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 64143-64174 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 107187-107218 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 33840-33871 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 LC549807 Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence 165032-165063 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 LC549808 Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence 3104-3135 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042536 Citrobacter freundii strain E51 plasmid pE51_002, complete sequence 122356-122387 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041645 Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence 4976-5007 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 45091-45122 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052570 Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP040888 Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence 138678-138709 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP035380 Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence 56582-56613 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 49057-49088 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024280 Escherichia coli strain ATCC 43896 plasmid unnamed2 47997-48028 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP023479 Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence 124688-124719 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN310373 Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence 42674-42705 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN310374 Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence 88257-88288 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN310376 Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence 42163-42194 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP049605 Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence 179826-179857 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 75820-75851 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026551 Citrobacter sp. SL156 plasmid unnamed2 40041-40072 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 117760-117791 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 LR134252 Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2 118861-118892 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 74023-74054 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP012989 Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence 37522-37553 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_017319 Shigella flexneri 2002017 plasmid pSFxv_1, complete sequence 217392-217423 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025944 Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence 88656-88687 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP031799 Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence 36561-36592 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 61592-61623 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP008824 UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence 173952-173983 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041514 Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence 199989-200020 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 46042-46073 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041093 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence 79849-79880 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042482 Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence 111283-111314 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP021956 Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence 22215-22246 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP021956 Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence 35490-35521 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP021956 Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence 47877-47908 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP021956 Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence 87239-87270 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP021956 Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence 93571-93602 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP034326 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence 46803-46834 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP035182 Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncR, complete sequence 9751-9782 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 25428-25459 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP052873 Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence 83400-83431 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP012142 Shigella flexneri 4c strain 1205 plasmid 1205p2, complete sequence 216101-216132 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044154 Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence 89721-89752 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028792 Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence 42564-42595 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP015132 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence 13270-13301 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042513 Serratia marcescens strain E28 plasmid pE28_001, complete sequence 5433-5464 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028991 Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence 44269-44300 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029135 Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence 69433-69464 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 45091-45122 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052554 Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence 3128-3159 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052176 Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence 40972-41003 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052193 Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence 40972-41003 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP034933 Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence 130399-130430 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP021680 Escherichia coli strain AR_0162 plasmid tig00002623, complete sequence 17514-17545 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP040862 Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence 152742-152773 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP019840 Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence 29574-29605 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052266 Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP038004 Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence 43434-43465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP007734 Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence 39026-39057 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026175 Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence 169638-169669 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 20379-20410 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026180 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence 26398-26429 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 38614-38645 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 52950-52981 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 70095-70126 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP039526 Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence 375388-375419 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052302 Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP031581 Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence 39444-39475 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029598 Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence 91033-91064 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP047337 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence 258313-258344 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP030234 Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence 28799-28830 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP030234 Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence 74314-74345 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP036307 Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence 43434-43465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP022149 Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence 94852-94883 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052380 Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052525 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence 5441-5472 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 33840-33871 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_AP019689 Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence 133055-133086 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP030066 Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence 118140-118171 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP030068 Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence 26295-26326 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028549 Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence 87709-87740 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028551 Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence 27856-27887 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042495 Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence 12092-12123 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042495 Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence 78913-78944 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042495 Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence 151775-151806 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP009116 Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence 92277-92308 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052281 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-1, complete sequence 3128-3159 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052282 Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence 40973-41004 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 116161-116192 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP009855 UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence 70796-70827 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP015026 Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence 25313-25344 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 54443-54474 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026390 Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence 170512-170543 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP013027 Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence 159459-159490 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP008907 Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence 28162-28193 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052289 Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence 3168-3199 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP008842 Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence 137978-138009 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP022824 Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence 107372-107403 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP036447 Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence 55443-55474 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_019125 Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence 9054-9085 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 43861-43892 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 400232-400263 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 9917-9948 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP010154 Escherichia coli strain D9 plasmid B, complete genome 56611-56642 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP043759 Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence 44402-44433 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 25112-25143 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025457 Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence 115712-115743 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP027370 Escherichia coli strain 2014C-3307 plasmid unnamed2 62351-62382 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP034130 Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence 132482-132513 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP034677 Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence 3160-3191 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 42128-42159 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052423 Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence 180206-180237 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052545 Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_LR130553 Escherichia coli strain MS14386 isolate MS14386 plasmid 2 99653-99684 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 158094-158125 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 15265-15296 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 189861-189892 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024524 Klebsiella pneumoniae strain INF158 plasmid unnamed3, complete sequence 3112-3143 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052387 Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence 109204-109235 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018961 Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence 226344-226375 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 180193-180224 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026154 Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence 105121-105152 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018451 Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence 61512-61543 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029387 Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence 107150-107181 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP017451 Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence 90059-90090 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP032173 Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence 145191-145222 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 74471-74502 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 133667-133698 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052534 Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026211 Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence 17823-17854 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP042546 Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence 36077-36108 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028121 Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence 788-819 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029723 Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence 178796-178827 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 88465-88496 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP034138 Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence 132479-132510 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026578 Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence 3245-3276 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 173097-173128 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026198 Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence 61069-61100 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP031809 Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence 176371-176402 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP032212 Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence 15857-15888 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP014697 Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence 134213-134244 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MG288679 Klebsiella pneumoniae plasmid p911021-tetA, complete sequence 136385-136416 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP007038 Shigella flexneri G1663 plasmid pG1663, complete sequence 216616-216647 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence 3136-3167 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052504 Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP030773 Shigella flexneri 1c strain Y394 plasmid pINV-Y394, complete sequence 218191-218222 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP011623 Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence 29676-29707 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 132221-132252 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 76960-76991 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 57220-57251 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 93920-93951 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 96925-96956 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 26997-27028 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_LR740759 Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202 75959-75990 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP011576 Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-50, complete sequence 1553-1584 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044377 Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence 80224-80255 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044381 Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence 200882-200913 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029688 Escherichia coli strain E706 plasmid pLKJULY7989, complete sequence 39171-39202 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025577 Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence 112956-112987 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP050827 Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence 133617-133648 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052521 Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_LT883139 Escherichia coli isolate 6666666.257727.embl plasmid I 61303-61334 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_LT883139 Escherichia coli isolate 6666666.257727.embl plasmid I 104034-104065 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP047574 Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence 12772-12803 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041935 Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence 66036-66067 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041936 Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence 98550-98581 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP023143 Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence 13290-13321 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP023144 Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence 48082-48113 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052436 Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence 16723-16754 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024573 Klebsiella pneumoniae strain INF274 plasmid unnamed3, complete sequence 3112-3143 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 AP022352 Klebsiella pneumoniae E208 plasmid pE208_IMP6 DNA, complete sequence 3144-3175 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052352 Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence 3120-3151 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP020087 Shigella flexneri 1a strain 0670 plasmid unnamed1, complete sequence 87437-87468 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_AP014952 Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence 203797-203828 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 68201-68232 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041922 Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence 55320-55351 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 45091-45122 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP024566 Klebsiella pneumoniae strain INF278 plasmid unnamed3, complete sequence 3112-3143 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 131052-131083 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026851 UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1 110164-110195 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP038456 Escherichia coli strain EC-129 plasmid pEC129_3 5374-5405 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP012993 Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence 156629-156660 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP028782 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence 3136-3167 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP044386 Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence 211738-211769 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 131997-132028 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052393 Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence 3120-3151 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052479 Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-3, complete sequence 3128-3159 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_AP019401 Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence 141385-141416 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_AP019405 Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence 209838-209869 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP032176 Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence 23027-23058 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 132168-132199 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 132434-132465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 131905-131936 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP020337 Shigella flexneri 4c strain 1602 plasmid unnamed1, complete sequence 181542-181573 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052471 Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence 39648-39679 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP020343 Shigella flexneri 1a strain 0439 plasmid unnamed1, complete sequence 138242-138273 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP023943 Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence 19921-19952 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP014763 Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence 41775-41806 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP021734 Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence 14882-14913 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 129590-129621 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 25530-25561 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 180664-180695 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP019905 Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence 55173-55204 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 132065-132096 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 131959-131990 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 41020-41051 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052173 Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 25531-25562 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_LT985234 Escherichia coli strain 557 plasmid RCS32TR557_p, complete sequence 52494-52525 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 184114-184145 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 143427-143458 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK413723 Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence 173656-173687 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 62594-62625 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 61210-61241 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 92609-92640 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK413719 Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence 124162-124193 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 142939-142970 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK413721 Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence 173168-173199 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MN268580 Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence 12272-12303 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP041086 Klebsiella pneumoniae strain Kp202 plasmid pKp202_4, complete sequence 3128-3159 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025683 Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence 103095-103126 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 CP052279 Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP045942 Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_01, complete sequence 8064-8095 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 43434-43465 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK036889 Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence 133836-133867 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 147653-147684 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MK191024 Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence 177882-177913 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 169213-169244 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MH733011 Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence 85690-85721 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_017724 Escherichia coli ETEC H10407 plasmid p948, complete sequence 50820-50851 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_017724 Escherichia coli ETEC H10407 plasmid p948, complete sequence 62612-62643 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP020091 Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence 84029-84060 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP016810 Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence 90356-90387 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP033251 Escherichia coli strain ECCHD184 plasmid pTB211, complete sequence 160558-160589 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 152020-152051 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP014778 Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence 116414-116445 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 95474-95505 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MF156696 Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence 40921-40952 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MF174860 Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence 69896-69927 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MF344581 Enterobacter cloacae strain 13E573 plasmid p13E573-HI2, complete sequence 230639-230670 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 79798-79829 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 50944-50975 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 50997-51028 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN823997 Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence 32698-32729 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MN824000 Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence 119441-119472 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 32413-32444 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018448 Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence 1296-1327 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MF072965 Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence 73351-73382 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MF072965 Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence 149479-149510 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MG288676 Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence 12756-12787 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MG764551 Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence 40971-41002 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MG845200 Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence 168424-168455 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_MG845201 Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence 168508-168539 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_004851 Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence 216984-217015 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 186237-186268 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP026370 Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence 100421-100452 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP035203 Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence 147318-147349 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 129-160 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 32269-32300 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP025462 Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence 150532-150563 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP048383 Citrobacter freundii strain 62 plasmid p6_A, complete sequence 211285-211316 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NZ_CP018737 Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1 57096-57127 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_021857 Shigella phage SfII, complete genome 40089-40120 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_028696 Salmonella phage SEN22, complete genome 17741-17772 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_028696 Salmonella phage SEN22, complete genome 40366-40397 10 0.688
CP027440_2 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder 1843128-1843159 32 NC_005344 Enterobacteria phage Sf6, complete genome 33866-33897 10 0.688
CP027440_2 2.19|1842699|34|CP027440|CRT 1842699-1842732 34 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 270828-270861 10 0.706
CP027440_3 3.2|1868826|32|CP027440|CRISPRCasFinder,CRT 1868826-1868857 32 NZ_CP041930 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence 76475-76506 10 0.688
CP027440_3 3.2|1868826|32|CP027440|CRISPRCasFinder,CRT 1868826-1868857 32 NZ_CP043383 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence 57328-57359 10 0.688
CP027440_3 3.2|1868826|32|CP027440|CRISPRCasFinder,CRT 1868826-1868857 32 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 10488-10519 10 0.688
CP027440_3 3.7|1868827|32|CP027440|PILER-CR 1868827-1868858 32 NZ_CP041930 Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence 76475-76506 10 0.688
CP027440_3 3.7|1868827|32|CP027440|PILER-CR 1868827-1868858 32 NZ_CP043383 Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence 57328-57359 10 0.688
CP027440_3 3.7|1868827|32|CP027440|PILER-CR 1868827-1868858 32 NZ_CP049048 Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence 10488-10519 10 0.688
CP027440_2 2.17|1842576|34|CP027440|CRT 1842576-1842609 34 NC_010391 Salmonella phage Fels-1, complete genome 29009-29042 11 0.676
CP027440_2 2.19|1842699|34|CP027440|CRT 1842699-1842732 34 NC_007103 Bacillus cereus E33L plasmid pE33L466, complete sequence 20705-20738 11 0.676
CP027440_2 2.19|1842699|34|CP027440|CRT 1842699-1842732 34 NZ_CP009967 Bacillus cereus E33L plasmid pBCO_1, complete sequence 301435-301468 11 0.676
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229227-229283 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229429-229485 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239721-239777 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239923-239979 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230633-230689 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230835-230891 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211603-211659 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211805-211861 11 0.807
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229328-229384 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 43-99 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239822-239878 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 42-98 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 18328-18384 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230734-230790 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 42-98 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211704-211760 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 42-98 13 0.772
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4114-4170 14 0.754
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4113-4169 14 0.754
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4113-4169 14 0.754
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4113-4169 14 0.754
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7392-7448 14 0.754
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84216-84272 14 0.754
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 87115-87171 15 0.737
CP027440_6 6.1|4029206|57|CP027440|CRISPRCasFinder 4029206-4029262 57 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15004-15060 15 0.737
CP027440_5 5.1|3139026|57|CP027440|CRISPRCasFinder 3139026-3139082 57 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30155-30211 16 0.719

1. spacer 1.1|645408|49|CP027440|CRISPRCasFinder matches to KJ603229 (Shigella phage POCJ13, complete genome) position: , mismatch: 0, identity: 1.0 

gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	CRISPR spacer
gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	Protospacer
*************************************************

2. spacer 1.1|645408|49|CP027440|CRISPRCasFinder matches to NC_029120 (Shigella phage 75/02 Stx, complete genome) position: , mismatch: 0, identity: 1.0 

gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	CRISPR spacer
gactgcacattggtgtgactgcacatcttcacagacggtcccggtatct	Protospacer
*************************************************

3. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

4. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

5. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

6. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

7. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

8. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

9. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

10. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

11. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

12. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

13. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

14. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

15. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

16. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

17. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

18. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

19. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

20. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

21. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

22. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

23. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

24. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

25. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

26. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

27. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_KX880944 (Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

28. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP045829 (Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

29. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP035549 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_89, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

30. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP042632 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

31. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP019188 (Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

32. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP034163 (Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

33. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP026725 (Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

34. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

35. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MN232192 (Escherichia coli plasmid pGD27-62, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

36. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP028585 (Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

37. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP009051 (Escherichia coli NCCP15648 plasmid p15648-1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

38. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP030183 (Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

39. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP032875 (Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

40. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP038378 (Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

41. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

42. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

43. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

44. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP022733 (Escherichia coli strain SA186 plasmid pSA186_4, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

45. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP022228 (Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

46. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_AP018809 (Escherichia coli strain E2865 plasmid pE2865-1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

47. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

48. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

49. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP021537 (Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

50. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP023732 (Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

51. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to CP050999 (Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

52. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP011430 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_89, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

53. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP032492 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_91, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

54. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP032497 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_75, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

55. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

56. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP013030 (Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

57. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MF510496 (Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

58. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP029365 (Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

59. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP030784 (Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

60. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP052881 (Escherichia coli strain C21 plasmid pC21-4, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

61. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP034164 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

62. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP020051 (Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

63. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP028125 (Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

64. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

65. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

66. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

67. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_LT985263 (Escherichia coli strain 511 plasmid RCS54_p, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

68. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MN101851 (Escherichia coli strain 13ZX28 plasmid p13ZX28-90, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

69. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MN101855 (Escherichia coli strain 13ZX36 plasmid p13ZX36-90, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

70. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

71. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

72. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MG825379 (Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

73. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MG288678 (Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

74. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP038288 (Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

75. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MH160767 (Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

76. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_042128 (Escherichia phage RCS47, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

77. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

78. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MF356679 (Escherichia phage D6, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

79. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_KX880944 (Escherichia coli strain pMCR-1-P3 plasmid pMCR-1-P3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

80. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP045829 (Escherichia coli strain AUSMDU00014361 plasmid pAUSMDU00014361_02, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

81. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP035549 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU07-18 plasmid pYU07-18_89, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

82. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP042632 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-5, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

83. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP019188 (Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 plasmid pATCC10729_02, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

84. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP034163 (Escherichia albertii strain 06-3542 plasmid p06-3542, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

85. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP026725 (Escherichia coli strain 266917_2 plasmid p266917_2_02, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

86. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP021729 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

87. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MN232192 (Escherichia coli plasmid pGD27-62, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

88. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP028585 (Escherichia coli strain WCHEC4533 plasmid p1_000533, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

89. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP009051 (Escherichia coli NCCP15648 plasmid p15648-1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

90. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP030183 (Salmonella enterica strain SA20030575 plasmid pSA20030575.2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

91. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP032875 (Escherichia coli strain WCHEC000837 plasmid p1_000837, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

92. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP038378 (Escherichia coli O157:H7 strain F1273 plasmid pF1273-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

93. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

94. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

95. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

96. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP022733 (Escherichia coli strain SA186 plasmid pSA186_4, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

97. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP022228 (Escherichia coli strain WCHEC96200 plasmid p1_000200, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

98. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_AP018809 (Escherichia coli strain E2865 plasmid pE2865-1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

99. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP021720 (Escherichia coli strain AR_0128 plasmid tig00000793, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

100. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

101. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP021537 (Escherichia coli strain AR_0119 plasmid unitig_3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

102. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP023732 (Escherichia coli strain FORC 064 plasmid pFORC64.1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

103. spacer 3.8|1868888|32|CP027440|PILER-CR matches to CP050999 (Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

104. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP011430 (Salmonella enterica subsp. enterica serovar Typhimurium strain YU39 isolate YUHS 05-78 plasmid pYU39_89, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

105. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP032492 (Salmonella enterica subsp. enterica serovar Typhimurium strain SL26 plasmid pSL26_91, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

106. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP032497 (Salmonella enterica subsp. enterica serovar Typhimurium strain SO21 plasmid pSO21_75, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

107. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

108. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP013030 (Escherichia coli strain 2012C-4227 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

109. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MF510496 (Klebsiella pneumoniae strain SCKP-LL83 plasmid pMCR_SCKP-LL83, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

110. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP029365 (Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

111. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP030784 (Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

112. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP052881 (Escherichia coli strain C21 plasmid pC21-4, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

113. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP034164 (Escherichia albertii strain 2014C-4015 plasmid p2014C-4015-2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

114. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP020051 (Escherichia coli strain AR_0118 plasmid unitig_3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

115. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP028125 (Escherichia coli O26 str. RM10386 plasmid pRM10386-1, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

116. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP026938 (Escherichia coli strain CFS3292 plasmid pCFS3292-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

117. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

118. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

119. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_LT985263 (Escherichia coli strain 511 plasmid RCS54_p, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

120. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MN101851 (Escherichia coli strain 13ZX28 plasmid p13ZX28-90, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

121. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MN101855 (Escherichia coli strain 13ZX36 plasmid p13ZX36-90, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

122. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

123. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MH580301 (Escherichia coli strain 1107 plasmid p1107-99K, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

124. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MG825379 (Escherichia coli strain 1108 plasmid p1108-IncY, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

125. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MG288678 (Klebsiella pneumoniae strain F160070 plasmid p160070-MCR, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

126. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP038288 (Escherichia coli O157:H7 strain TX 376-2 plasmid pTX376-2, complete sequence) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

127. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MH160767 (Escherichia phage vB_EcoM-Ro157c2YLVW, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

128. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_042128 (Escherichia phage RCS47, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

129. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

130. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MF356679 (Escherichia phage D6, complete genome) position: , mismatch: 0, identity: 1.0 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacgtcaccagaccgctaacgacg	Protospacer
********************************

131. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

132. spacer 2.14|1842393|34|CP027440|CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

133. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

134. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

135. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

136. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

137. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

138. spacer 2.14|1842393|34|CP027440|CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

139. spacer 2.14|1842393|34|CP027440|CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

140. spacer 2.14|1842393|34|CP027440|CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

141. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

142. spacer 2.14|1842393|34|CP027440|CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

143. spacer 2.14|1842393|34|CP027440|CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

144. spacer 2.14|1842393|34|CP027440|CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

145. spacer 2.14|1842393|34|CP027440|CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

146. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

147. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

148. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

149. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

150. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

151. spacer 2.14|1842393|34|CP027440|CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

152. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

153. spacer 2.14|1842393|34|CP027440|CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

154. spacer 2.14|1842393|34|CP027440|CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

155. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccctttaacgtcaccagaccgctaacgacg	Protospacer
 *******************************

156. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to LT906557 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctataacgtcaccagaccgctaacgacg	Protospacer
****** *************************

157. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP027309 (Escherichia coli strain 2015C-3108 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacctcaccagaccgctaacgacg	Protospacer
*********** ********************

158. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP047663 (Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctataacgtcaccagaccgctaacgacg	Protospacer
****** *************************

159. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP034790 (Escherichia coli strain ECCNB20-2 plasmid pTB423, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctataacgtcaccagaccgctaacgacg	Protospacer
****** *************************

160. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MK356558 (Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg-	CRISPR spacer
acccctttaacgtcaccagaccg-taacgacgc	Protospacer
*********************** ********

161. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccctttaacgtcaccagaccgctaacgacg	Protospacer
 *******************************

162. spacer 3.8|1868888|32|CP027440|PILER-CR matches to LT906557 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: II) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctataacgtcaccagaccgctaacgacg	Protospacer
****** *************************

163. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP027309 (Escherichia coli strain 2015C-3108 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctttaacctcaccagaccgctaacgacg	Protospacer
*********** ********************

164. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP047663 (Escherichia coli strain LD93-1 plasmid pLD93-1-90kb, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctataacgtcaccagaccgctaacgacg	Protospacer
****** *************************

165. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP034790 (Escherichia coli strain ECCNB20-2 plasmid pTB423, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
acccctataacgtcaccagaccgctaacgacg	Protospacer
****** *************************

166. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MK356558 (Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence) position: , mismatch: 1, identity: 0.969 

acccctttaacgtcaccagaccgctaacgacg-	CRISPR spacer
acccctttaacgtcaccagaccg-taacgacgc	Protospacer
*********************** ********

167. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

168. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

169. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

170. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

171. spacer 2.1|1842395|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcataacgtgtttttacc	Protospacer
***************** * ************

172. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

173. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

174. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

175. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_KU980950 (Escherichia coli strain WE-0250 plasmid U2501, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

176. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

177. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP010146 (Escherichia coli strain D5 plasmid A, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

178. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

179. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP043218 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

180. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

181. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_LT905089 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

182. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP034959 (Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

183. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP020522 (Escherichia coli strain 190 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

184. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP019281 (Escherichia coli strain 13P484A plasmid p13P484A-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

185. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP047090 (Salmonella sp. S13 plasmid pS13-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

186. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_LR130557 (Escherichia coli strain MS14385 isolate MS14385 plasmid 3) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

187. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP015997 (Escherichia coli strain S51 plasmid pS51_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

188. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

189. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP041960 (Escherichia coli strain EC2 plasmid pEC2_5, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

190. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP027133 (Escherichia coli strain AR_0372 plasmid unnamed4) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

191. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

192. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

193. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP039843 (Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

194. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

195. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP035313 (Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

196. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP021203 (Escherichia coli strain Z1002 plasmid p1002-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

197. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP029103 (Escherichia coli strain AR437 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

198. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

199. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

200. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to CP043746 (Escherichia coli strain CVM N16EC0879 plasmid pN16EC0879-2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

201. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

202. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP031232 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

203. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP023896 (Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

204. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP009168 (Escherichia coli 1303 plasmid p1303_95, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

205. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

206. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP023381 (Escherichia coli strain 127 plasmid p91, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

207. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP040069 (Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

208. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

209. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

210. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

211. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_017653 (Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

212. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

213. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP019054 (Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

214. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

215. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP041630 (Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

216. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP041922 (Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

217. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

218. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

219. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP033882 (Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

220. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

221. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

222. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

223. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP031654 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

224. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MK419152 (Escherichia coli strain D72C plasmid pD72C, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

225. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MK410117 (Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

226. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MK455768 (Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

227. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

228. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MH844525 (Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

229. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_MK256965 (Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

230. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

231. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

232. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP027199 (Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

233. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to AF234173 (Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

234. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

235. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_005856 (Enterobacteria phage P1, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

236. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to AP012536 (Stx2-converting phage Stx2a_1447 proviral DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

237. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to JQ182728 (Enterobacteria phage mEp460, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

238. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

239. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to KF030445 (Escherichia phage 1720a-02, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

240. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MF807953 (Escherichia phage Ayreon, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

241. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_049941 (Stx2-converting phage Stx2a_WGPS2 proviral DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

242. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to NC_009514 (Phage cdtI DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

243. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

244. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to LR595862 (Escherichia virus Lambda_2H10 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

245. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to AF234172 (Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

246. spacer 3.3|1868887|32|CP027440|CRISPRCasFinder,CRT matches to MK356558 (Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
aactctttaacgtcaccagaccgctaacgacg	Protospacer
* *.****************************

247. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

248. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

249. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MF679145 (Escherichia coli plasmid pBJ114-96, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

250. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_KU980950 (Escherichia coli strain WE-0250 plasmid U2501, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

251. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

252. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP010146 (Escherichia coli strain D5 plasmid A, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

253. spacer 3.8|1868888|32|CP027440|PILER-CR matches to CP054337 (Escherichia coli strain SCU-120 plasmid pSCU-120-2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

254. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP043218 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.1-IncY, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

255. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP010173 (Escherichia coli strain H8 plasmid A, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

256. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_LT905089 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-243 genome assembly, plasmid: 1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

257. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP034959 (Escherichia coli strain WCHEC020032 plasmid p1_020032, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

258. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP020522 (Escherichia coli strain 190 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

259. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP019281 (Escherichia coli strain 13P484A plasmid p13P484A-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

260. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP047090 (Salmonella sp. S13 plasmid pS13-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

261. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_LR130557 (Escherichia coli strain MS14385 isolate MS14385 plasmid 3) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

262. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP015997 (Escherichia coli strain S51 plasmid pS51_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

263. spacer 3.8|1868888|32|CP027440|PILER-CR matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

264. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP041960 (Escherichia coli strain EC2 plasmid pEC2_5, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

265. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP027133 (Escherichia coli strain AR_0372 plasmid unnamed4) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

266. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP040920 (Escherichia coli strain FC853_EC plasmid p853EC1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

267. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

268. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP039843 (Escherichia coli O157:H7 strain USDA5905 plasmid pUSDA5905_1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

269. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP024832 (Escherichia coli strain CREC-532 plasmid pCREC-532_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

270. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP035313 (Escherichia coli strain D72 plasmid pD72-mcr1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

271. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP021203 (Escherichia coli strain Z1002 plasmid p1002-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

272. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP029103 (Escherichia coli strain AR437 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

273. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP024817 (Escherichia coli strain CREC-629 plasmid pCREC-629_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

274. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

275. spacer 3.8|1868888|32|CP027440|PILER-CR matches to CP043746 (Escherichia coli strain CVM N16EC0879 plasmid pN16EC0879-2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

276. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP029117 (Escherichia coli strain AR435 plasmid unnamed4) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

277. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP031232 (Escherichia coli strain Es_ST410_NW1_NDM_09_2017 plasmid pEsST410_NW_2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

278. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP023896 (Escherichia coli strain FDAARGOS_433 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

279. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP009168 (Escherichia coli 1303 plasmid p1303_95, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

280. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP023961 (Escherichia coli strain FDAARGOS_448 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

281. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP023381 (Escherichia coli strain 127 plasmid p91, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

282. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP040069 (Escherichia coli strain A1_181 plasmid p_unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

283. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

284. spacer 3.8|1868888|32|CP027440|PILER-CR matches to AP023222 (Escherichia coli M505 plasmid pM505-b DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

285. spacer 3.8|1868888|32|CP027440|PILER-CR matches to AP023233 (Escherichia coli YJ4 plasmid pYJ4-b DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

286. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_017653 (Escherichia coli O55:H7 str. RM12579 plasmid p12579_1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

287. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

288. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP019054 (Escherichia coli strain CRE1540 plasmid p1540-3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

289. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP019075 (Escherichia coli strain CRE1493 plasmid p1493-4, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

290. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP041630 (Escherichia coli strain PE15 plasmid pPE15-92K, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

291. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP041922 (Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

292. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP015837 (Escherichia coli strain MS6198 plasmid pMS6198C, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

293. spacer 3.8|1868888|32|CP027440|PILER-CR matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

294. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP033882 (Escherichia coli strain 50579417 plasmid p50579417_1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

295. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP033848 (Escherichia coli strain FDAARGOS_497 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

296. spacer 3.8|1868888|32|CP027440|PILER-CR matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

297. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP016549 (Escherichia coli strain O177:H21 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

298. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP031654 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_01, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

299. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MK419152 (Escherichia coli strain D72C plasmid pD72C, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

300. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MK410117 (Escherichia coli strain Ec-20Lar plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

301. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MK455768 (Escherichia coli strain Ec-2Lar plasmid pY-Ec2, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

302. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

303. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MH844525 (Escherichia coli strain SCEC128 plasmid pSCEC128, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

304. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_MK256965 (Escherichia coli strain R15 plasmid pR15_MCR-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

305. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

306. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP011063 (Escherichia coli str. Sanji plasmid pSJ_98, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

307. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NZ_CP027199 (Escherichia coli strain WCHEC025943 plasmid p1_025943, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

308. spacer 3.8|1868888|32|CP027440|PILER-CR matches to AF234173 (Enterobacteria phage P1 mod1902::IS5 c1.100 rev dmt(del)MB mutant, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

309. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

310. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_005856 (Enterobacteria phage P1, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

311. spacer 3.8|1868888|32|CP027440|PILER-CR matches to AP012536 (Stx2-converting phage Stx2a_1447 proviral DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

312. spacer 3.8|1868888|32|CP027440|PILER-CR matches to JQ182728 (Enterobacteria phage mEp460, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

313. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

314. spacer 3.8|1868888|32|CP027440|PILER-CR matches to KF030445 (Escherichia phage 1720a-02, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

315. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MF807953 (Escherichia phage Ayreon, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

316. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_049941 (Stx2-converting phage Stx2a_WGPS2 proviral DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

317. spacer 3.8|1868888|32|CP027440|PILER-CR matches to NC_009514 (Phage cdtI DNA, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

318. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

319. spacer 3.8|1868888|32|CP027440|PILER-CR matches to LR595862 (Escherichia virus Lambda_2H10 genome assembly, chromosome: 1) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
tcccctttaacgtccccagaccgctaacgacg	Protospacer
 ************* *****************

320. spacer 3.8|1868888|32|CP027440|PILER-CR matches to AF234172 (Enterobacteria phage P1 mod749::IS5 c1.100 mutant, complete genome) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
ccccttttaacgtcaccagaccgctaacgacg	Protospacer
 ***.***************************

321. spacer 3.8|1868888|32|CP027440|PILER-CR matches to MK356558 (Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence) position: , mismatch: 2, identity: 0.938 

acccctttaacgtcaccagaccgctaacgacg	CRISPR spacer
aactctttaacgtcaccagaccgctaacgacg	Protospacer
* *.****************************

322. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaacgtgttttcacc	Protospacer
* ******************* ********.***

323. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaacgtgttttcacc	Protospacer
* ******************* ********.***

324. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgacggtttagaccgtgtttttacc	Protospacer
* ********* *****.****************

325. spacer 2.14|1842393|34|CP027440|CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcataacgtgtttttacc	Protospacer
* ***************** * ************

326. spacer 2.14|1842393|34|CP027440|CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgacggtttagaccgtgtttttacc	Protospacer
* ********* *****.****************

327. spacer 2.3|1842517|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP011408 (Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence) position: , mismatch: 5, identity: 0.844 

ttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
actccgaccgcgaaagactggaaaaccaatct	Protospacer
 . **.***** ********************

328. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to MT230402 (Escherichia coli strain DH5alpha plasmid pESBL87, complete sequence) position: , mismatch: 5, identity: 0.912 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctac-aactattgccgaccc	CRISPR spacer
atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaaaccgttaccgact-	Protospacer
****************************************** ***..**.*****.

329. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 5, identity: 0.912 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
aattgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaacttg	Protospacer
..***************************************************..*.

330. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 5, identity: 0.912 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
aattgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaacttg	Protospacer
..***************************************************..*.

331. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 5, identity: 0.912 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
aattgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaacttg	Protospacer
..***************************************************..*.

332. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 5, identity: 0.912 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
aattgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaacttg	Protospacer
..***************************************************..*.

333. spacer 2.3|1842517|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP054046 (Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

ttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
aacccgaccgccaaagactggaaaaccaactt	Protospacer
   **.***********************..*

334. spacer 2.16|1842515|34|CP027440|CRT matches to NZ_CP011408 (Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence) position: , mismatch: 6, identity: 0.824 

acttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
tcactccgaccgcgaaagactggaaaaccaatct	Protospacer
 * . **.***** ********************

335. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.895 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
agttatgcgcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttg	Protospacer
.***.************************.***********************..*.

336. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.895 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
agttatgcgcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttg	Protospacer
.***.************************.***********************..*.

337. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.895 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
agttatgcgcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttg	Protospacer
.***.************************.***********************..*.

338. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.895 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
agttatgcgcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttg	Protospacer
.***.************************.***********************..*.

339. spacer 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
tcggctgaacagggagcgggataccggcgtaa	Protospacer
  ************** *** *******..*.

340. spacer 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

341. spacer 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021367 (Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

342. spacer 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

343. spacer 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021363 (Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

344. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 7, identity: 0.877 

-ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
cgctggtgc-cggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaaactg	Protospacer
 * * **** *.******************.*********************** **.

345. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 7, identity: 0.877 

-ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
cgctggtgc-cggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaaactg	Protospacer
 * * **** *.******************.*********************** **.

346. spacer 2.2|1842456|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP011054 (Halomonas sp. KO116 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggctgaacagggagggggctaccg---gcacag	CRISPR spacer
agagctgaacagggtgggggttaccgctcgca---	Protospacer
...*********** *****.*****   ***

347. spacer 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

tttctttttccatttaagttattctaataccc	CRISPR spacer
tcttgttttccagtttagttattctaataagt	Protospacer
*.*. ******* ** *************  .

348. spacer 2.16|1842515|34|CP027440|CRT matches to NZ_CP054046 (Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765 

acttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
ttaacccgaccgccaaagactggaaaaccaactt	Protospacer
 .   **.***********************..*

349. spacer 2.19|1842699|34|CP027440|CRT matches to JN638751 (Bacillus phage G, complete genome) position: , mismatch: 8, identity: 0.765 

tctttctttttccatttaagttatt----ctaataccc	CRISPR spacer
tctttctttttccatctaatttatctatactaac----	Protospacer
***************.*** ****.    ****.

350. spacer 2.4|1842578|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_010391 (Salmonella phage Fels-1, complete genome) position: , mismatch: 9, identity: 0.719 

ttaaacttgccgccggtatggggggaacgggc	CRISPR spacer
gggtggttgccgccggtatggggggaatggcg	Protospacer
  . . *********************.**

351. spacer 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 9, identity: 0.719 

tttctttttccatttaagttattctaataccc	CRISPR spacer
tcctgttttccagtttagttattctaataagt	Protospacer
*... ******* ** *************  .

352. spacer 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 9, identity: 0.719 

tttctttttccatttaagttattctaataccc	CRISPR spacer
tcctgttttccagtttagttattctaataagt	Protospacer
*... ******* ** *************  .

353. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP008935 (Geobacillus stearothermophilus 10 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
gcggatggcagcctccccccttaaccgggcaa	Protospacer
 . *. * *********** ****** ****

354. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026937 (Escherichia coli strain CFS3292 plasmid pCFS3292-2, complete sequence) position: , mismatch: 9, identity: 0.719 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
caccccaaaagcctcccccattaccccggaac	Protospacer
* *   .  ************** ***** **

355. spacer 2.15|1842454|34|CP027440|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
ggtcggctgaacagggagcgggataccggcgtaa	Protospacer
.   ************** *** *******..*.

356. spacer 2.15|1842454|34|CP027440|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

357. spacer 2.15|1842454|34|CP027440|CRT matches to NZ_CP021367 (Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

358. spacer 2.15|1842454|34|CP027440|CRT matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

359. spacer 2.15|1842454|34|CP027440|CRT matches to NZ_CP021363 (Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

360. spacer 3.5|1869009|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 9, identity: 0.719 

gatcaacggcctggcggctgcctctgaaatct	CRISPR spacer
catcatcggcctggcggccgcctcaatgctca	Protospacer
 **** ************.***** . . **

361. spacer 3.5|1869009|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gatcaacggcctggcggctgcctctgaaatct	CRISPR spacer
gatcaccggcctggaggctgccttccggcact	Protospacer
***** ******** ********.. ..  **

362. spacer 3.5|1869009|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gatcaacggcctggcggctgcctctgaaatct	CRISPR spacer
gatcaccggcctggaggctgccttccggcact	Protospacer
***** ******** ********.. ..  **

363. spacer 3.10|1869010|32|CP027440|PILER-CR matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 9, identity: 0.719 

gatcaacggcctggcggctgcctctgaaatct	CRISPR spacer
catcatcggcctggcggccgcctcaatgctca	Protospacer
 **** ************.***** . . **

364. spacer 3.10|1869010|32|CP027440|PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gatcaacggcctggcggctgcctctgaaatct	CRISPR spacer
gatcaccggcctggaggctgccttccggcact	Protospacer
***** ******** ********.. ..  **

365. spacer 3.10|1869010|32|CP027440|PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gatcaacggcctggcggctgcctctgaaatct	CRISPR spacer
gatcaccggcctggaggctgccttccggcact	Protospacer
***** ******** ********.. ..  **

366. spacer 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 10, identity: 0.688 

tttctttttccatttaagttattctaataccc	CRISPR spacer
catgtttttacatttaagtttttctaaacaga	Protospacer
. * ***** ********** ******

367. spacer 2.6|1842701|32|CP027440|PILER-CR,CRISPRCasFinder matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 10, identity: 0.688 

tttctttttccatttaagttattctaataccc	CRISPR spacer
catgtttttacatttaagtttttctaaacaga	Protospacer
. * ***** ********** ******

368. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026049 (Raoultella planticola strain FDAARGOS_64 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

369. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018351 (Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

370. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018674 (Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

371. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP014073 (Klebsiella quasipneumoniae strain FDAARGOS_93 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

372. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029493 (Escherichia coli strain HS30-1 plasmid pHS30-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

373. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034786 (Escherichia coli strain ECZP248 plasmid pTB402, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

374. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP009414 (Salmonella enterica strain CFSAN007428 isolate N11150 plasmid pCFSAN007428_01, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

375. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_KX458222 (Klebsiella pneumoniae strain B2 plasmid pB2-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

376. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_KX960110 (Escherichia coli strain CREC-TJ2 plasmid pCREC-TJ2-NDM, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

377. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_KU295131 (Escherichia coli strain BK28009 plasmid pBK28009, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

378. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP038792 (Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

379. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP010130 (Escherichia coli strain C9 plasmid A, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

380. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP012988 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-CTX, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

381. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044528 (Klebsiella grimontii strain SS141 plasmid plamid_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

382. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

383. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP050844 (Klebsiella pneumoniae strain Bckp186 plasmid pBckp186, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

384. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP013323 (Klebsiella pneumoniae strain CAV1193 plasmid pCAV1193-258, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

385. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025857 (Escherichia coli strain 504838 plasmid p504838_108, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

386. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025858 (Escherichia coli strain 504838 plasmid p504838_88, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

387. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025858 (Escherichia coli strain 504838 plasmid p504838_88, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

388. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

389. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP050830 (Klebsiella pneumoniae strain Bckp067 plasmid pBckp067, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

390. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052410 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

391. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052450 (Klebsiella pneumoniae strain C16KP0077 plasmid pC16KP0077-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

392. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP023417 (Klebsiella pneumoniae strain 1050 plasmid pKp1050-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

393. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

394. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052491 (Klebsiella pneumoniae strain B17KP0069 plasmid pB17KP0069-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

395. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028805 (Klebsiella pneumoniae strain WCHKP7E2 plasmid pKPC2_085072, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

396. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP012994 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-SIL, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

397. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024194 (Klebsiella pneumoniae isolate KSB1_5D plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

398. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

399. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_014107 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_A, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

400. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052311 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

401. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN543585 (Klebsiella pneumoniae strain GH27TC plasmid pGH27TC_fusion, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

402. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_010886 (Klebsiella pneumoniae plasmid pK245, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

403. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP010179 (Escherichia coli strain H15 plasmid A, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

404. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052296 (Klebsiella pneumoniae strain E16KP0210 plasmid pE16KP0210-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

405. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026804 (Shigella flexneri strain 89-141 plasmid unnamed1) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

406. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026794 (Shigella flexneri strain 74-1170 plasmid unnamed) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

407. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP033511 (Shigella flexneri strain 2016AM-0877 plasmid p2016AM-0877, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

408. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

409. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

410. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

411. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042507 (Leclercia adecarboxylata strain E1 plasmid pE1_002, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

412. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_AP019010 (Serratia marcescens strain AS-1 plasmid pSERAS01, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

413. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN543571 (Klebsiella pneumoniae strain GH27 plasmid pGH27_175, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

414. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

415. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026789 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

416. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

417. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026237 (Citrobacter freundii complex sp. CFNIH3 plasmid pCFR-9161, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

418. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

419. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026170 (Leclercia sp. LSNIH1 plasmid pLEC-000f, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

420. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034059 (Shigella flexneri strain FDAARGOS_535 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

421. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024476 (Shigella flexneri 7b strain 94-3007 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

422. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024476 (Shigella flexneri 7b strain 94-3007 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

423. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LR213456 (Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 2) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

424. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026771 (Shigella flexneri Y strain 93-3063 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

425. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044157 (Shigella flexneri strain AR-0424 plasmid pAR-0424-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

426. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

427. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

428. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

429. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

430. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

431. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028955 (Klebsiella pneumoniae strain AR_0141 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

432. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_023333 (Klebsiella pneumoniae strain ST23 plasmid pKP007, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

433. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029181 (Escherichia coli strain H9Ecoli plasmid p1-H9, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

434. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN232190 (Escherichia coli plasmid pGD27-31, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

435. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052405 (Klebsiella pneumoniae strain C17KP0020 plasmid pC17KP0020-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

436. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052137 (Klebsiella pneumoniae strain F17KP0054 plasmid pF17KP0054-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

437. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP012138 (Shigella flexneri 2a strain 981 plasmid 981p1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

438. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044160 (Shigella flexneri strain AR-0423 plasmid pAR-0423-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

439. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to LC556210 (Enterobacter cloacae CC23 plasmid pCC23 DNA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

440. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

441. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

442. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

443. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

444. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

445. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to LC549807 (Klebsiella pneumoniae VNCKp115 plasmid pVNCKp115 DNA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

446. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to LC549808 (Klebsiella pneumoniae VNCKp83 plasmid pVNCKp83 DNA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

447. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042536 (Citrobacter freundii strain E51 plasmid pE51_002, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

448. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041645 (Klebsiella pneumoniae strain NKU_Kleb8A7 plasmid pKleb8A7, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

449. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

450. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052570 (Klebsiella pneumoniae strain A16KP0119 plasmid pA16KP0119-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

451. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP040888 (Leclercia adecarboxylata strain Z96-1 plasmid pZ96-1_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

452. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP035380 (Leclercia adecarboxylata strain R25 plasmid pLA-109, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

453. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

454. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024280 (Escherichia coli strain ATCC 43896 plasmid unnamed2) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

455. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP023479 (Klebsiella quasipneumoniae strain KPC142 plasmid pKQPS142a, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

456. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN310373 (Klebsiella pneumoniae strain BJ20 plasmid pBJ20-tetA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

457. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN310374 (Klebsiella pneumoniae strain 2016071221 plasmid p71221-tetA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

458. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN310376 (Klebsiella pneumoniae strain 08291 plasmid pW08291-tetA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

459. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP049605 (Klebsiella pneumoniae strain Kp8701 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

460. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

461. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026551 (Citrobacter sp. SL156 plasmid unnamed2) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

462. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

463. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

464. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

465. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP012989 (Klebsiella pneumoniae strain KpN01 plasmid pKpN01-SIL, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

466. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_017319 (Shigella flexneri 2002017 plasmid pSFxv_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

467. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025944 (Escherichia coli strain SCEC020023 plasmid pOXA10_020023, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

468. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP031799 (Klebsiella pneumoniae strain QMP B2-170 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

469. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

470. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP008824 (UNVERIFIED_ORG: Enterobacter cloacae ECNIH2 plasmid pKEC-39c, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

471. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041514 (Klebsiella michiganensis strain KNU07 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

472. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

473. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041093 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH01 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

474. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

475. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

476. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

477. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

478. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

479. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021956 (Klebsiella pneumoniae strain AR_0107 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

480. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034326 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-qnrS, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

481. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP035182 (Klebsiella pneumoniae strain BA33875 plasmid pBA33875_IncR, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

482. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

483. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP052873 (Enterobacter cloacae strain 3849 plasmid p3846III, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

484. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP012142 (Shigella flexneri 4c strain 1205 plasmid 1205p2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

485. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044154 (Shigella flexneri strain AR-0425 plasmid pAR-0425-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

486. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028792 (Klebsiella pneumoniae strain WCHKP020030 plasmid pQnrS1_020030, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

487. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP015132 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-d90, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

488. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042513 (Serratia marcescens strain E28 plasmid pE28_001, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

489. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028991 (Klebsiella pneumoniae strain AR_0142 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

490. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029135 (Klebsiella pneumoniae strain AR376 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

491. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

492. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052554 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

493. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052176 (Klebsiella pneumoniae strain F16KP0050 plasmid pF16KP0050-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

494. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

495. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034933 (Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

496. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021680 (Escherichia coli strain AR_0162 plasmid tig00002623, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

497. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP040862 (Klebsiella pneumoniae strain Xen39 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

498. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP019840 (Enterobacter roggenkampii strain R11 plasmid pASM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

499. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052266 (Klebsiella pneumoniae strain E16KP0287 plasmid pE16K0287-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

500. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP038004 (Klebsiella pneumoniae strain SCKP020009 plasmid pLAP2_020009, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

501. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP007734 (Klebsiella pneumoniae subsp. pneumoniae KPNIH27 plasmid pKPN-262, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

502. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026175 (Klebsiella pneumoniae strain KPNIH50 plasmid pKPC-0cc9, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

503. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

504. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026180 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-9729, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

505. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

506. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

507. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

508. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP039526 (Klebsiella pneumoniae subsp. pneumoniae strain HB25-1 plasmid pHB25-1-vir, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

509. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052302 (Klebsiella pneumoniae strain E16KP0180 plasmid pE16KP0180-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

510. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP031581 (Klebsiella pneumoniae strain N4b plasmid pIncFIA-1502320, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

511. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029598 (Klebsiella quasipneumoniae subsp. similipneumoniae strain ATCC 700603 plasmid pDA33145-152, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

512. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP047337 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-mcr8-345kb, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

513. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030234 (Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

514. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030234 (Salmonella enterica strain SA20101045 plasmid pSA20101045.1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

515. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP036307 (Klebsiella pneumoniae strain WCHKP020098 plasmid p1_020098, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

516. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP022149 (Enterobacter roggenkampii strain 704SK10 plasmid p704SK10_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

517. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052380 (Klebsiella pneumoniae strain D16KP0017 plasmid pD16KP0017-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

518. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052525 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

519. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

520. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_AP019689 (Klebsiella quasipneumoniae strain SNI47 plasmid pTMSNI47-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

521. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030066 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

522. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030068 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

523. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

524. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028551 (Klebsiella variicola strain WCHKP19 plasmid p3_020019, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

525. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042495 (Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

526. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042495 (Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

527. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042495 (Leclercia adecarboxylata strain E61 plasmid pE61_002, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

528. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP009116 (Klebsiella pneumoniae strain carbapenem-resistant blaNDM-1 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

529. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052281 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

530. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052282 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

531. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

532. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP009855 (UNVERIFIED_ORG: Enterobacter cloacae strain ECNIH5 plasmid pENT-22e, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

533. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP015026 (Klebsiella pneumoniae strain Kpn223 plasmid pKPN-065, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

534. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

535. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026390 (Leclercia sp. LSNIH3 plasmid pLEC-5e18, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

536. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

537. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP008907 (Enterobacter hormaechei subsp. hoffmannii ECR091 plasmid pENT-4bd, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

538. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052289 (Klebsiella pneumoniae strain E16KP0218 plasmid pE16KP0218-3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

539. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP008842 (Klebsiella michiganensis strain M1 plasmid pKOXM1A, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

540. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP022824 (Klebsiella quasivariicola strain KPN1705 plasmid pKPN1705-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

541. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP036447 (Klebsiella pneumoniae strain KPNIH45 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

542. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_019125 (Salmonella enterica subsp. salamae plasmid pSGSC3045-121, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

543. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

544. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

545. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

546. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP010154 (Escherichia coli strain D9 plasmid B, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

547. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP043759 (Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

548. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

549. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025457 (Klebsiella pneumoniae strain KP69 plasmid p69-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

550. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP027370 (Escherichia coli strain 2014C-3307 plasmid unnamed2) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

551. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034130 (Klebsiella quasipneumoniae strain G4584 plasmid pG4584_218.9Kb, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

552. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034677 (Klebsiella quasipneumoniae strain D120-1 plasmid pD120-1_80kb, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

553. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

554. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

555. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052545 (Klebsiella pneumoniae strain B16KP0102 plasmid pB16KP0102-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

556. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LR130553 (Escherichia coli strain MS14386 isolate MS14386 plasmid 2) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

557. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

558. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

559. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

560. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024524 (Klebsiella pneumoniae strain INF158 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

561. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

562. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

563. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052387 (Klebsiella pneumoniae strain C17KP0055 plasmid pC17KP0055-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

564. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018961 (Escherichia coli strain Ecol_422 plasmid pEC422_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

565. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

566. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026154 (Klebsiella pneumoniae strain F10(AN) plasmid pF10AN_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacatcaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

567. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018451 (Klebsiella pneumoniae strain Kp_Goe_71070 plasmid pKp_Goe_070-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

568. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029387 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP040074 plasmid pTetD_040074, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

569. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP017451 (Klebsiella sp. LTGPAF-6F plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

570. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP032173 (Klebsiella pneumoniae strain AR_0160 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

571. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

572. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

573. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052534 (Klebsiella pneumoniae strain B16KP0157 plasmid pB16KP0157-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

574. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026211 (Citrobacter sp. CFNIH10 plasmid pCIT-eb1a, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

575. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP042546 (Klebsiella michiganensis strain C52 plasmid pC52_001, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

576. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028121 (Escherichia coli O43 str. RM10042 plasmid pRM10042-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

577. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029723 (Klebsiella pneumoniae strain AR_0140 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

578. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

579. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP034138 (Klebsiella quasipneumoniae subsp. similipneumoniae strain G747 plasmid pG747_218.9Kb, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

580. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026578 (Escherichia coli strain WCHEC005237 plasmid pQnrS1_005237, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

581. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

582. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026198 (Enterobacteriaceae bacterium ENNIH3 plasmid pKPC-c606, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

583. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP031809 (Klebsiella pneumoniae strain INF206-sc-2280074 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

584. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP032212 (Klebsiella pneumoniae strain AR_0109 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

585. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP014697 (Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

586. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MG288679 (Klebsiella pneumoniae plasmid p911021-tetA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

587. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP007038 (Shigella flexneri G1663 plasmid pG1663, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

588. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pQnrB52_020046, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

589. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052504 (Klebsiella pneumoniae strain B17KP0020 plasmid pB17KP0020-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

590. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP030773 (Shigella flexneri 1c strain Y394 plasmid pINV-Y394, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

591. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP011623 (Klebsiella pneumoniae strain CAV1344 plasmid pCAV1344-250, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

592. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

593. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

594. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

595. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

596. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

597. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

598. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

599. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

600. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

601. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP011576 (Klebsiella pneumoniae strain CAV1392 plasmid pCAV1392-50, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

602. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044377 (Klebsiella pneumoniae strain 2018S06-082 plasmid p2018S06-082-1_MCR1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

603. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044381 (Klebsiella pneumoniae strain 2018S07-013 plasmid p2018S07-013-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

604. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029688 (Escherichia coli strain E706 plasmid pLKJULY7989, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

605. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

606. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025577 (Klebsiella pneumoniae strain 08EU827 plasmid p08EU827_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

607. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP050827 (Klebsiella pneumoniae strain Bckp212 plasmid pBckp212-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

608. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052521 (Klebsiella pneumoniae strain B16KP0198 plasmid pB16KP0198-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

609. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LT883139 (Escherichia coli isolate 6666666.257727.embl plasmid I) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

610. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LT883139 (Escherichia coli isolate 6666666.257727.embl plasmid I) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

611. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP047574 (Escherichia coli strain 2EC1 plasmid p2EC1-3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

612. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041935 (Klebsiella pneumoniae strain KP14003 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

613. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041936 (Klebsiella pneumoniae strain KP14003 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

614. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

615. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP023144 (Escherichia coli strain CFSAN061770 plasmid pEGY2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

616. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052436 (Klebsiella pneumoniae strain C16KP0108 plasmid pC16KP0108-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

617. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024573 (Klebsiella pneumoniae strain INF274 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

618. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to AP022352 (Klebsiella pneumoniae E208 plasmid pE208_IMP6 DNA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

619. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

620. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP020087 (Shigella flexneri 1a strain 0670 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

621. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_AP014952 (Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

622. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

623. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041922 (Escherichia coli strain Ec40743 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

624. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

625. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP024566 (Klebsiella pneumoniae strain INF278 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

626. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

627. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026851 (UNVERIFIED_ORG: Enterobacter cloacae strain AR_0072 plasmid unnamed1) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

628. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP038456 (Escherichia coli strain EC-129 plasmid pEC129_3) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

629. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP012993 (Klebsiella pneumoniae strain KpN06 plasmid pKpN06-CTX, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

630. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP028782 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020046 plasmid pCTXM27_020046, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

631. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP044386 (Klebsiella pneumoniae strain 2018C01-239 plasmid p2018C01-239-1_MCR1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

632. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

633. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

634. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

635. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052393 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

636. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052479 (Klebsiella pneumoniae strain C16KP0050 plasmid pC16KP0050-3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

637. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_AP019401 (Klebsiella pneumoniae strain E013 plasmid pE013, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

638. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_AP019405 (Klebsiella pneumoniae strain E196 plasmid pE196_IMP6, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

639. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP032176 (Klebsiella pneumoniae strain AR_0135 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

640. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

641. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

642. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

643. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP020337 (Shigella flexneri 4c strain 1602 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

644. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052471 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

645. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP020343 (Shigella flexneri 1a strain 0439 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

646. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP023943 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

647. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP014763 (Klebsiella pneumoniae strain KPNIH39 plasmid pKPN-332, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

648. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP021734 (Escherichia coli strain AR_0114 plasmid unitig_2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

649. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

650. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

651. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

652. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP019905 (Escherichia coli strain MDR_56 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

653. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

654. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

655. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

656. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052173 (Klebsiella pneumoniae strain F16KP0064 plasmid pF16KP0064-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

657. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

658. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LT985234 (Escherichia coli strain 557 plasmid RCS32TR557_p, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

659. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

660. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

661. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK413723 (Klebsiella pneumoniae strain 130721005 plasmid p721005-HI3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

662. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

663. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

664. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

665. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK413719 (Klebsiella pneumoniae strain 362713 plasmid p362713-HI3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

666. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

667. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK413721 (Klebsiella pneumoniae strain 130504051 plasmid p504051-HI3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

668. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MN268580 (Klebsiella pneumoniae strain KP13-53 plasmid pKP13-53-tet(A), complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

669. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP041086 (Klebsiella pneumoniae strain Kp202 plasmid pKp202_4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

670. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025683 (Klebsiella pneumoniae strain L5-2 plasmid pL5201, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

671. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to CP052279 (Klebsiella pneumoniae strain E16KP0235 plasmid pE16KP0235-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

672. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP045942 (Shigella flexneri 2a strain AUSMDU00010535 plasmid pAUSMDU00010535_01, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

673. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

674. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK036889 (Klebsiella pneumoniae strain A1966 plasmid pA1966-IMP, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

675. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

676. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MK191024 (Klebsiella pneumoniae strain KP17-16 plasmid p17-16-vir, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

677. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

678. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MH733011 (Klebsiella pneumoniae strain KP16103 plasmid pKP16103-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

679. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_017724 (Escherichia coli ETEC H10407 plasmid p948, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

680. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_017724 (Escherichia coli ETEC H10407 plasmid p948, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

681. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP020091 (Enterobacter cloacae strain PIMB10EC27 plasmid pEC27-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

682. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP016810 (Klebsiella pneumoniae strain DHQP1002001 plasmid p_IncFIB_DHQP1002001, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

683. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP033251 (Escherichia coli strain ECCHD184 plasmid pTB211, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

684. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

685. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP014778 (Pluralibacter gergoviae strain FB2 plasmid pFB2.3, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

686. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

687. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MF156696 (Klebsiella pneumoniae strain 1642 plasmid p1642-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

688. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

689. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MF344581 (Enterobacter cloacae strain 13E573 plasmid p13E573-HI2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

690. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

691. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

692. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

693. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN823997 (Klebsiella pneumoniae strain 111119051 plasmid p19051-FIIK, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

694. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MN824000 (Klebsiella pneumoniae strain 397108 plasmid p397108-FIIK, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

695. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

696. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018448 (Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

697. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

698. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MF072965 (Citrobacter freundii strain P10159 plasmid pP10159-5, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

699. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MG288676 (Klebsiella pneumoniae strain F160070 plasmid p160070-catA, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

700. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MG764551 (Klebsiella pneumoniae strain A1705 plasmid pA1705-qnrS, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

701. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MG845200 (Klebsiella oxytoca strain TJ11 plasmid pNDM-TJ11, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

702. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_MG845201 (Klebsiella pneumoniae strain TJ03 plasmid pNDM-TJ03, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

703. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_004851 (Shigella flexneri 2a str. 301 plasmid pCP301, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

704. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

705. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP026370 (Klebsiella quasipneumoniae strain A708 plasmid pA708-2, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

706. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP035203 (Klebsiella pneumoniae strain LH94 plasmid pLH94-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

707. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

708. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

709. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP025462 (Klebsiella pneumoniae strain F44 plasmid p44-1, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

710. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP048383 (Citrobacter freundii strain 62 plasmid p6_A, complete sequence) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

711. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NZ_CP018737 (Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

712. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_021857 (Shigella phage SfII, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

713. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_028696 (Salmonella phage SEN22, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

714. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_028696 (Salmonella phage SEN22, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

715. spacer 2.13|1843128|32|CP027440|PILER-CR,CRISPRCasFinder matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 10, identity: 0.688 

ctcggggccagcctcccccattaacccggcac	CRISPR spacer
aacaccaaaagcctcccccattaccccggaac	Protospacer
  *.  .  ************** ***** **

716. spacer 2.19|1842699|34|CP027440|CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706 

tctttctttttccatttaagttattctaataccc	CRISPR spacer
aatcttgttttccagtttagttattctaataagt	Protospacer
  *.*. ******* ** *************  .

717. spacer 3.2|1868826|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgtttctaatctcaccgccacggcgatcaa	CRISPR spacer
atagcacttaatcccagcgccacggcgatcag	Protospacer
   *. ..*****.** **************.

718. spacer 3.2|1868826|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgtttctaatctcaccgccacggcgatcaa	CRISPR spacer
atagcacttaatcccagcgccacggcgatcag	Protospacer
   *. ..*****.** **************.

719. spacer 3.2|1868826|32|CP027440|CRISPRCasFinder,CRT matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgtttctaatctcaccgccacggcgatcaa	CRISPR spacer
atagcacttaatcccagcgccacggcgatcag	Protospacer
   *. ..*****.** **************.

720. spacer 3.7|1868827|32|CP027440|PILER-CR matches to NZ_CP041930 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374C, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgtttctaatctcaccgccacggcgatcaa	CRISPR spacer
atagcacttaatcccagcgccacggcgatcag	Protospacer
   *. ..*****.** **************.

721. spacer 3.7|1868827|32|CP027440|PILER-CR matches to NZ_CP043383 (Enterobacter hormaechei subsp. xiangfangensis strain WCHEX045001 plasmid pNDM1_045001, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgtttctaatctcaccgccacggcgatcaa	CRISPR spacer
atagcacttaatcccagcgccacggcgatcag	Protospacer
   *. ..*****.** **************.

722. spacer 3.7|1868827|32|CP027440|PILER-CR matches to NZ_CP049048 (Enterobacter hormaechei strain Y233 plasmid p233-142, complete sequence) position: , mismatch: 10, identity: 0.688 

cgcgtttctaatctcaccgccacggcgatcaa	CRISPR spacer
atagcacttaatcccagcgccacggcgatcag	Protospacer
   *. ..*****.** **************.

723. spacer 2.17|1842576|34|CP027440|CRT matches to NC_010391 (Salmonella phage Fels-1, complete genome) position: , mismatch: 11, identity: 0.676 

acttaaacttgccgccggtatggggggaacgggc	CRISPR spacer
gggggtggttgccgccggtatggggggaatggcg	Protospacer
.   . . *********************.**

724. spacer 2.19|1842699|34|CP027440|CRT matches to NC_007103 (Bacillus cereus E33L plasmid pE33L466, complete sequence) position: , mismatch: 11, identity: 0.676 

tctttctttttccatttaagttattctaataccc	CRISPR spacer
aatcctgttttccagtttagttattctaataagt	Protospacer
  *... ******* ** *************  .

725. spacer 2.19|1842699|34|CP027440|CRT matches to NZ_CP009967 (Bacillus cereus E33L plasmid pBCO_1, complete sequence) position: , mismatch: 11, identity: 0.676 

tctttctttttccatttaagttattctaataccc	CRISPR spacer
aatcctgttttccagtttagttattctaataagt	Protospacer
  *... ******* ** *************  .

726. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

727. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

728. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

729. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

730. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

731. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

732. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

733. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.807 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc--	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaa--attcccgcgccat	Protospacer
.. .*****************. *********************  *** ***  **

734. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaattctcgcgccac	Protospacer
.. .*****************. ********************* * .*  ** * *

735. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatctgtacgcgaa--	Protospacer
....****************** ************ ********  **.*   ***

736. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaattctcgcgccac	Protospacer
.. .*****************. ********************* * .*  ** * *

737. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatctgtacgcgaa--	Protospacer
....****************** ************ ********  **.*   ***

738. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatctgtacgcgaa--	Protospacer
....****************** ************ ********  **.*   ***

739. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaattctcgcgccac	Protospacer
.. .*****************. ********************* * .*  ** * *

740. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatctgtacgcgaa--	Protospacer
....****************** ************ ********  **.*   ***

741. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctaacgcgtcttatcaggcctacaaattctcgcgccac	Protospacer
.. .*****************. ********************* * .*  ** * *

742. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 13, identity: 0.772 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaaatctgtacgcgaa--	Protospacer
....****************** ************ ********  **.*   ***

743. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 14, identity: 0.754 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttgtgcctgaa--	Protospacer
.. .****************** ************ ********  .*.*  *.**

744. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 14, identity: 0.754 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttgtgcctgaa--	Protospacer
.. .****************** ************ ********  .*.*  *.**

745. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 14, identity: 0.754 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttgtgcctgaa--	Protospacer
.. .****************** ************ ********  .*.*  *.**

746. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 14, identity: 0.754 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaa--ctattgccgaccc	CRISPR spacer
gcagatgcctgatgcgacgctggcgcgtcttatcatgcctacaaacttgtgcctgaa--	Protospacer
.. .****************** ************ ********  .*.*  *.**

747. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 14, identity: 0.754 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctac--aactattgccgaccc	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaaactgcactcaac--	Protospacer
 . .****************** ************ ******  ****..  .*.**

748. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 14, identity: 0.754 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctac--aactattgccgaccc	CRISPR spacer
ccggatgcctgatgcgacgctggcgcgtcttatcatgcctacaaaactgcactcaac--	Protospacer
 . .****************** ************ ******  ****..  .*.**

749. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.737 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc	CRISPR spacer
cacgatgcctgatgcgacgctgccgcgtcttatcaggcctacaaaatcaatcgcttt	Protospacer
  *.******************.*********************   . ..** ...

750. spacer 6.1|4029206|57|CP027440|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 15, identity: 0.737 

ggttgtgcgcagatgcctgatgcgacgctagcgcgtcttatcatgcctacaaatcta	CRISPR spacer
aacaattaccaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccg	Protospacer
... .*   ***.****************.********************.*..*..

751. spacer 5.1|3139026|57|CP027440|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 16, identity: 0.719 

atcaatgcctgatgcgacgctgtcgcgtcttatcaggcctacaactattgccgaccc	CRISPR spacer
tctgatgcctgatgcgacgctgacgcgtcttatcatgcctacaatctgcacccgaac	Protospacer
 ...****************** ************ ********..  ..** .  *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage