1. spacer 2.1|793072|40|CP027584|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975
acagcacagcggggggaatttcaagaatgacccgcagcgc CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc Protospacer
*************** ************************
2. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 5, identity: 0.839
-gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
gagattgt-cgccctgttgggcgagaacggtg Protospacer
.*.**** ******* *******.*******
3. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812
-gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
gagattgt-cgccctgttgggcgagaacggtgc Protospacer
.*.**** ******* *******.*******
4. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
-gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
gaggacgt-tgccctggtcggcgaagacggtgg Protospacer
.** .** .******** ******.*******
5. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
6. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
7. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
8. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
9. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
10. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
11. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
12. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
gatttctctaatgcacaaagatatagctataa Protospacer
****** ****** ************.. *
13. spacer 4.13|2767907|32|CP027584|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cgccgcggactcacgagcaggccatcacagac- CRISPR spacer
aggcgcgaactgacgagcaggccatc-cacgcg Protospacer
* ****.*** ************** ** .*
14. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
aaggtcaccgccctgatcggcgaaaacggtg Protospacer
..* * *******.* *************
15. spacer 4.3|2767297|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tccgcatcgctcatgccgataatcgggctcgg CRISPR spacer
ccggaactgctgatgccgatgatcgggctcga Protospacer
.* * *..*** ********.**********.
16. spacer 4.3|2767297|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75
tccgcatcgctcatgccgataatcgggctcgg CRISPR spacer
cacgccgagctcatcccgataatcggggtcga Protospacer
. *** ****** ************ ***.
17. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaagaaagcaaata Protospacer
*.** ** *********** ******** .
18. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaggaaagcaaata Protospacer
*.** ** *********** ******** .
19. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaggaaagcaaata Protospacer
*.** ** *********** ******** .
20. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaggaaagcaaata Protospacer
*.** ** *********** ******** .
21. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaggaaagcaaata Protospacer
*.** ** *********** ******** .
22. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to NC_020385 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaggaaagcaaata Protospacer
*.** ** *********** ******** .
23. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaggaaagcaaata Protospacer
*.** ** *********** ******** .
24. spacer 4.8|2767602|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
agcaccactgaaaatctgtacgaaagcaatag CRISPR spacer
aacaagacagaaaatctgtaggaaagcaaata Protospacer
*.** ** *********** ******** .
25. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.75
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
agtcacggcaatgctcaaaggcatagccggat Protospacer
.*. * *.***********..**********
26. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.75
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
agtcacggcaatgctcaaaggcatagccggat Protospacer
.*. * *.***********..**********
27. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.75
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
agtcacggcaatgctcaaaggcatagccggat Protospacer
.*. * *.***********..**********
28. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.75
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
agtcacggcaatgctcaaaggcatagccggat Protospacer
.*. * *.***********..**********
29. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.75
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
agtcacggcaatgctcaaaggcatagccggat Protospacer
.*. * *.***********..**********
30. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
agtcacggcaatgctcaaaggcatagccggat Protospacer
.*. * *.***********..**********
31. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
agtcacggcaatgctcaaaggcatagccggat Protospacer
.*. * *.***********..**********
32. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
33. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
34. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
35. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
36. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
37. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
38. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
39. spacer 4.28|2767663|33|CP027584|PILER-CR matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
gatttctctaatgcacaaagatatagctataag Protospacer
****** ****** ************.. *
40. spacer 4.28|2767663|33|CP027584|PILER-CR matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
agtcacggcaatgctcaaaggcatagccggatc Protospacer
.*. * *.***********..***********
41. spacer 4.28|2767663|33|CP027584|PILER-CR matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
agtcacggcaatgctcaaaggcatagccggatc Protospacer
.*. * *.***********..***********
42. spacer 4.28|2767663|33|CP027584|PILER-CR matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
agtcacggcaatgctcaaaggcatagccggatc Protospacer
.*. * *.***********..***********
43. spacer 4.28|2767663|33|CP027584|PILER-CR matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
agtcacggcaatgctcaaaggcatagccggatc Protospacer
.*. * *.***********..***********
44. spacer 4.28|2767663|33|CP027584|PILER-CR matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
agtcacggcaatgctcaaaggcatagccggatc Protospacer
.*. * *.***********..***********
45. spacer 4.28|2767663|33|CP027584|PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
agtcacggcaatgctcaaaggcatagccggatc Protospacer
.*. * *.***********..***********
46. spacer 4.28|2767663|33|CP027584|PILER-CR matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.758
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
agtcacggcaatgctcaaaggcatagccggatc Protospacer
.*. * *.***********..***********
47. spacer 3.7|2751401|32|CP027584|CRISPRCasFinder,CRT matches to AP014927 (Ralstonia phage RSF1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
atctccagcgccttttcgacgcaacggtgcgc CRISPR spacer
cacgccagcgcctgttcgacgaaacgggtctg Protospacer
* ********* ******* ***** *
48. spacer 3.9|2751523|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 9, identity: 0.719
ccagattccgctttctctaccttctctttttc CRISPR spacer
aagaaaaacgcttcctctacattctctttttc Protospacer
..* *****.****** ***********
49. spacer 3.9|2751523|32|CP027584|CRISPRCasFinder,CRT matches to KY579375 (Sulfolobus spindle-shaped virus 3 strain REY 15/4, complete genome) position: , mismatch: 9, identity: 0.719
ccagattccgctttctctaccttctctttttc CRISPR spacer
aagaaaatcgctttctctactttctctttgtc Protospacer
..* .************.******** **
50. spacer 3.9|2751523|32|CP027584|CRISPRCasFinder,CRT matches to EU030939 (Sulfolobus spindle-shaped virus 5, complete genome) position: , mismatch: 9, identity: 0.719
ccagattccgctttctctaccttctctttttc CRISPR spacer
aagaaaatcgctttctctactttctctttgtc Protospacer
..* .************.******** **
51. spacer 3.9|2751523|32|CP027584|CRISPRCasFinder,CRT matches to JF412294 (EBPR podovirus 1, partial sequence) position: , mismatch: 9, identity: 0.719
ccagattccgctttctctaccttctctttttc CRISPR spacer
gccttcgctgctttctcggccttctctttttc Protospacer
* . *.******** .*************
52. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
53. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
54. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
55. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
56. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
aaggtcaccgccctgatcggcgaaaacggtgc Protospacer
..* * *******.* *************
57. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
58. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
59. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
60. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
61. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
62. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
63. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
64. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
65. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
66. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
67. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
68. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
69. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
70. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggacg Protospacer
. * ****************** .*** *
71. spacer 3.13|2751523|31|CP027584|PILER-CR matches to NZ_CP033139 (Vibrio owensii strain 1700302 plasmid pVOWZ1, complete sequence) position: , mismatch: 9, identity: 0.71
ccagattccgctttctctaccttctcttttt CRISPR spacer
aagaaaaacgcttcctctacattctcttttt Protospacer
..* *****.****** **********
72. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
73. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
74. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
75. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
76. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
77. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
78. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
79. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
80. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
81. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
82. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
83. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
84. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
85. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
86. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
87. spacer 3.14|2751584|31|CP027584|PILER-CR matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
88. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
89. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.71
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
atcgtctgcgccctggtgggcgaacgcggac Protospacer
. * ****************** .***
90. spacer 4.2|2767236|32|CP027584|CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719
cgttcctcgcattatttccctttcttcttcga CRISPR spacer
ccgcgctcgctttgtttccctttcttctccat Protospacer
* . ***** **.**************.*.
91. spacer 4.3|2767297|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719
tccgcatcgctcatgccgataatcgggctcgg CRISPR spacer
tccgtatcgctcatgtcgataatcctaattca Protospacer
****.**********.******** . *. .
92. spacer 4.3|2767297|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
tccgcatcgctcatgccgataatcgggctcgg CRISPR spacer
agctcgaagcccatgccgatgatcgggctcgc Protospacer
* *. **.*********.**********
93. spacer 4.3|2767297|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
tccgcatcgctcatgccgataatcgggctcgg CRISPR spacer
agctcgaagcccatgccgatgatcgggctcgc Protospacer
* *. **.*********.**********
94. spacer 4.6|2767480|32|CP027584|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
ccgaacggctcggcgctctcatacccccaaat CRISPR spacer
tcgaacggctcggcgcccgcataccgttcgac Protospacer
.***************.* ****** .. .*.
95. spacer 4.6|2767480|32|CP027584|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgaacggctcggcgctctcatacccccaaat CRISPR spacer
acgaacgactcggcgcgctcatacgaacgttt Protospacer
******.******** ******* *. *
96. spacer 4.6|2767480|32|CP027584|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
ccgaacggctcggcgctctcatacccccaaat CRISPR spacer
acgaacgactcggcgcgctcatacgaacgttt Protospacer
******.******** ******* *. *
97. spacer 4.9|2767663|32|CP027584|CRISPRCasFinder,CRT matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 9, identity: 0.719
tatttctgtaatgctcaaagatatagccggat CRISPR spacer
aatttctgtattgctcaatgatatattgaggc Protospacer
********* ******* ****** . .*..
98. spacer 4.25|2767480|33|CP027584|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.727
ccgaacggctcggcgctctcatacccccaaatc CRISPR spacer
tcgaacggctcggcgcccgcataccgttcgacc Protospacer
.***************.* ****** .. .*.*
99. spacer 3.10|2751584|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gggttgtgcgccctggtgggcgaaaacggtgg CRISPR spacer
ttccctgccgccctggttggcgaatacggtgg Protospacer
.. ********* ****** *******
100. spacer 3.14|2751584|31|CP027584|PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.677
gggttgtgcgccctggtgggcgaaaacggtg CRISPR spacer
ttccctgccgccctggttggcgaatacggtg Protospacer
.. ********* ****** ******
101. spacer 4.1|2767175|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688
tttgccgctgtcagcattgctggcgcgtaata CRISPR spacer
ctggccgctgtcgccattgctggcgccatgct Protospacer
.* *********. ************ ..
102. spacer 4.1|2767175|32|CP027584|CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688
tttgccgctgtcagcattgctggcgcgtaata CRISPR spacer
ctggccgctgtcgccattgctggcgccatgct Protospacer
.* *********. ************ ..
103. spacer 4.1|2767175|32|CP027584|CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688
tttgccgctgtcagcattgctggcgcgtaata CRISPR spacer
ctggccgctgtcgccattgctggcgccatgct Protospacer
.* *********. ************ ..
104. spacer 4.1|2767175|32|CP027584|CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688
tttgccgctgtcagcattgctggcgcgtaata CRISPR spacer
ctggccgctgtcgccattgctggcgccatgct Protospacer
.* *********. ************ ..
105. spacer 4.3|2767297|32|CP027584|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
tccgcatcgctcatgccgataatcgggctcgg CRISPR spacer
tacgcatcgcccatgccgatgatcgccgcaac Protospacer
* ********.*********.**** . .
106. spacer 4.3|2767297|32|CP027584|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688
tccgcatcgctcatgccgataatcgggctcgg CRISPR spacer
tacgcatcgcccatgccgatgatcgccgcaac Protospacer
* ********.*********.**** . .
107. spacer 4.22|2767297|33|CP027584|PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 10, identity: 0.697
tccgcatcgctcatgccgataatcgggctcggc CRISPR spacer
tccgtatcgctcatgtcgataatcctaattcaa Protospacer
****.**********.******** . *. .
108. spacer 4.28|2767663|33|CP027584|PILER-CR matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 10, identity: 0.697
tatttctgtaatgctcaaagatatagccggatc CRISPR spacer
aatttctgtattgctcaatgatatattgaggca Protospacer
********* ******* ****** . .*..
