Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027589 Escherichia coli strain 2014C-3011 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP027591 Escherichia coli strain 2014C-3011 chromosome, complete genome 7 crisprs NA 0 4 0 0
CP027592 Escherichia coli strain 2014C-3011 plasmid unnamed3 0 crisprs NA 0 0 0 0
CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 0 crisprs NA 0 0 0 0

Results visualization

1. CP027591
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027591_1 488204-488324 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027591_2 830105-830193 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027591_3 857646-857799 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027591_4 2178762-2178885 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027591_5 3005038-3005129 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027591_6 3400870-3401014 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027591_7 4067312-4067427 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027591_5 5.1|3005064|40|CP027591|CRISPRCasFinder 3005064-3005103 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027591_7 7.1|4067343|54|CP027591|CRISPRCasFinder 4067343-4067396 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP027591_4 4.1|2178805|38|CP027591|CRISPRCasFinder 2178805-2178842 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027591_3 3.1|857678|29|CP027591|PILER-CR 857678-857706 29 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 19327-19355 6 0.793
CP027591_3 3.1|857678|29|CP027591|PILER-CR 857678-857706 29 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9220 7 0.759
CP027591_7 7.1|4067343|54|CP027591|CRISPRCasFinder 4067343-4067396 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778

1. spacer 5.1|3005064|40|CP027591|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

2. spacer 7.1|4067343|54|CP027591|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
***************************************************** 

3. spacer 4.1|2178805|38|CP027591|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

4. spacer 3.1|857678|29|CP027591|PILER-CR matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 6, identity: 0.793

gtttggtc--caccaaatgtttgatgcttca	CRISPR spacer
--ttacccgacaccaaatgtttggtgcttca	Protospacer
  **. .*  *************.*******

5. spacer 3.1|857678|29|CP027591|PILER-CR matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 7, identity: 0.759

gtttggtccaccaaatgtttgatgcttca	CRISPR spacer
tatcaatccaccaaatttttgattcttca	Protospacer
  *...********** ****** *****

6. spacer 7.1|4067343|54|CP027591|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage