Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027676 Escherichia coli strain 88-3510 plasmid unnamed 0 crisprs NA 0 0 0 0
CP027675 Escherichia coli strain 88-3510 chromosome, complete genome 7 crisprs NA 0 3 0 0

Results visualization

1. CP027675
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027675_1 500510-500600 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027675_2 527011-527094 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027675_3 946370-946490 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027675_4 2233874-2233986 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027675_5 2437510-2437625 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027675_6 3315452-3315600 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027675_7 3550872-3550963 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027675_5 5.1|2437541|54|CP027675|CRISPRCasFinder 2437541-2437594 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP027675_7 7.1|3550898|40|CP027675|CRISPRCasFinder 3550898-3550937 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027675_4 4.1|2233902|57|CP027675|CRISPRCasFinder 2233902-2233958 57 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15004-15060 11 0.807
CP027675_5 5.1|2437541|54|CP027675|CRISPRCasFinder 2437541-2437594 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
CP027675_4 4.1|2233902|57|CP027675|CRISPRCasFinder 2233902-2233958 57 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12104-12160 13 0.772
CP027675_4 4.1|2233902|57|CP027675|CRISPRCasFinder 2233902-2233958 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3364-3420 16 0.719
CP027675_4 4.1|2233902|57|CP027675|CRISPRCasFinder 2233902-2233958 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3363-3419 16 0.719
CP027675_4 4.1|2233902|57|CP027675|CRISPRCasFinder 2233902-2233958 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3363-3419 16 0.719
CP027675_4 4.1|2233902|57|CP027675|CRISPRCasFinder 2233902-2233958 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3363-3419 16 0.719

1. spacer 5.1|2437541|54|CP027675|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981 

gaatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	CRISPR spacer
caatgccggatgcgctttgcttatccggcctacaaaatcgcagcgtgtaggcca	Protospacer
 *****************************************************

2. spacer 7.1|3550898|40|CP027675|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

acagcacagcggggggaatttcaagaatgacccgcagcgc	CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc	Protospacer
*************** ************************

3. spacer 4.1|2233902|57|CP027675|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 11, identity: 0.807 

-acaataacagcattgcctgatgcgacgctcgcgcgtcttatcaggcctacgagttca	CRISPR spacer
aacaattacca-ggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcccg	Protospacer
 ***** ** . . **************** ************* *********..*.

4. spacer 5.1|2437541|54|CP027675|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778 

gaatgccggatgcgctttgcttatccggcctacaaaatcgc-----agcgtgtaggcca	CRISPR spacer
tactgccggatgcgctttgcttatccggcctacaataccgcgaattaatttgta-----	Protospacer
 * ******************************** *.***     *.. ****

5. spacer 4.1|2233902|57|CP027675|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.772 

-----acaataacagcattgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
ctccgacgtt-----cggtgcctgatgcgacgctggcgcgtcttatcaggcctacgagtc	Protospacer
     **. *     *. **************** ************************.

6. spacer 4.1|2233902|57|CP027675|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

7. spacer 4.1|2233902|57|CP027675|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

8. spacer 4.1|2233902|57|CP027675|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

9. spacer 4.1|2233902|57|CP027675|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 16, identity: 0.719 

acaataacagcat-----tgcctgatgcgacgctcgcgcgtcttatcaggcctacgagtt	CRISPR spacer
-----agttgtacgcaggtgcctgatgcgacgctggcgcgtcttatcatgcctacgagcc	Protospacer
     *.. *.*.     **************** ************* *********..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage