Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027553 Escherichia coli strain 2015C-4498 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP027552 Escherichia coli strain 2015C-4498 chromosome, complete genome 4 crisprs NA 0 7 0 0

Results visualization

1. CP027552
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027552_1 4022315-4022448 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027552_2 4058538-4058619 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027552_3 4906681-4907136 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027552_4 4932245-4932578 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 NC_004813 Enterobacteria phage BP-4795, complete genome 54801-54832 0 1.0
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 AJ556162 Phage BP-4795 complete genome 54801-54832 0 1.0
CP027552_3 3.1|4906710|32|CP027552|CRT 4906710-4906741 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP027552_1 1.1|4022353|58|CP027552|CRISPRCasFinder 4022353-4022410 58 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 104-161 5 0.914
CP027552_3 3.2|4906771|32|CP027552|CRT,CRISPRCasFinder 4906771-4906802 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027552_3 3.1|4906710|32|CP027552|CRT 4906710-4906741 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 NC_004813 Enterobacteria phage BP-4795, complete genome 54813-54844 8 0.75
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 AJ556162 Phage BP-4795 complete genome 54813-54844 8 0.75
CP027552_3 3.1|4906710|32|CP027552|CRT 4906710-4906741 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP027552_3 3.4|4906893|32|CP027552|CRT,CRISPRCasFinder,PILER-CR 4906893-4906924 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1022602-1022633 8 0.75
CP027552_3 3.5|4906954|32|CP027552|CRT,CRISPRCasFinder,PILER-CR 4906954-4906985 32 NZ_CP009293 Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence 271059-271090 8 0.75
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 196702-196733 9 0.719
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 NZ_CP032536 Bacillus megaterium NCT-2 plasmid pNCT2_8, complete sequence 12244-12275 9 0.719
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 HQ634174 Cyanophage MED4-213, complete genome 147764-147795 9 0.719
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 GU075905 Prochlorococcus phage P-HM2, complete genome 150138-150169 9 0.719
CP027552_2 2.1|4058563|32|CP027552|CRISPRCasFinder 4058563-4058594 32 GU071101 Prochlorococcus phage P-HM1, complete genome 145480-145511 9 0.719
CP027552_3 3.1|4906710|32|CP027552|CRT 4906710-4906741 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP027552_3 3.4|4906893|32|CP027552|CRT,CRISPRCasFinder,PILER-CR 4906893-4906924 32 MT932212 Salmonella phage VSe13, complete genome 11034-11065 9 0.719
CP027552_3 3.6|4907015|32|CP027552|CRT,CRISPRCasFinder,PILER-CR 4907015-4907046 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 903982-904013 10 0.688
CP027552_1 1.1|4022353|58|CP027552|CRISPRCasFinder 4022353-4022410 58 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7432-7489 11 0.81
CP027552_1 1.1|4022353|58|CP027552|CRISPRCasFinder 4022353-4022410 58 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84256-84313 11 0.81
CP027552_3 3.6|4907015|32|CP027552|CRT,CRISPRCasFinder,PILER-CR 4907015-4907046 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1467285-1467316 11 0.656

1. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to NC_004813 (Enterobacteria phage BP-4795, complete genome) position: , mismatch: 0, identity: 1.0 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacatctgctgcaacatccgctgcat	Protospacer
********************************

2. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to AJ556162 (Phage BP-4795 complete genome) position: , mismatch: 0, identity: 1.0 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacatctgctgcaacatccgctgcat	Protospacer
********************************

3. spacer 3.1|4906710|32|CP027552|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906 

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

4. spacer 1.1|4022353|58|CP027552|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 5, identity: 0.914 

agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattcag	CRISPR spacer
agacccgagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgatcgt	Protospacer
*********************** ****************************. **.

5. spacer 3.2|4906771|32|CP027552|CRT,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

6. spacer 3.1|4906710|32|CP027552|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781 

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

7. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to NC_004813 (Enterobacteria phage BP-4795, complete genome) position: , mismatch: 8, identity: 0.75 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
gactattgcatctgctgcaacatctgctgcaa	Protospacer
 .**.. .****************.******

8. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to AJ556162 (Phage BP-4795 complete genome) position: , mismatch: 8, identity: 0.75 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
gactattgcatctgctgcaacatctgctgcaa	Protospacer
 .**.. .****************.******

9. spacer 3.1|4906710|32|CP027552|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

10. spacer 3.4|4906893|32|CP027552|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75 

ctatagcgccacgttccgagcgctgcgagctg	CRISPR spacer
ttgtggaaccacggtccgagcgctgcgatctc	Protospacer
.*.*.* .***** ************** **

11. spacer 3.5|4906954|32|CP027552|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 8, identity: 0.75 

aacagtagcggagctggtgggcaatatcccgg------	CRISPR spacer
aaaaggagcggagctggtgggca------cggatagac	Protospacer
** ** *****************      ***

12. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
cgcctggccacctgctgcaacatgcgctgcac	Protospacer
.**.  . **.************ *******.

13. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to NZ_CP032536 (Bacillus megaterium NCT-2 plasmid pNCT2_8, complete sequence) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgcttcaacatctgcttcaacatgagaagtca	Protospacer
**** *********** ******  *  *.

14. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to HQ634174 (Cyanophage MED4-213, complete genome) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacagctgctgctacattcacattga	Protospacer
********** ******* ****.*.*  ..

15. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacagctgctgctacattcacattga	Protospacer
********** ******* ****.*.*  ..

16. spacer 2.1|4058563|32|CP027552|CRISPRCasFinder matches to GU071101 (Prochlorococcus phage P-HM1, complete genome) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacagctgctgctacattcacattga	Protospacer
********** ******* ****.*.*  ..

17. spacer 3.1|4906710|32|CP027552|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719 

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

18. spacer 3.4|4906893|32|CP027552|CRT,CRISPRCasFinder,PILER-CR matches to MT932212 (Salmonella phage VSe13, complete genome) position: , mismatch: 9, identity: 0.719 

ctatagcgccacgttccgagcgctgcgagctg	CRISPR spacer
cgatagcgccgcgttctgagcgctgatgtttt	Protospacer
* ********.*****.********  . .*

19. spacer 3.6|4907015|32|CP027552|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

caaaatattacgagcttcgtcaggccatggac	CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgc	Protospacer
.   ..**.*************** **** .*

20. spacer 1.1|4022353|58|CP027552|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.81 

---agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattca	CRISPR spacer
acaaaact---gcactcaaccgtaggccggataaggcgttcacgccgcatccggcaattg	Protospacer
   *.**.   ****  *************************************** *..

21. spacer 1.1|4022353|58|CP027552|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.81 

---agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattca	CRISPR spacer
acaaaact---gcactcaaccgtaggccggataaggcgttcacgccgcatccggcaattg	Protospacer
   *.**.   ****  *************************************** *..

22. spacer 3.6|4907015|32|CP027552|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

caaaatattacgagcttcgtcaggccatggac	CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgg	Protospacer
.   ..**.*************** **** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage