Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027586 Escherichia coli strain 2012EL-2448 chromosome, complete genome 3 crisprs NA 0 4 0 0

Results visualization

1. CP027586
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027586_1 1142944-1143338 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027586_2 1169056-1169144 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027586_3 4013354-4013499 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027586_1 1.6|1143278|32|CP027586|PILER-CR,CRISPRCasFinder,CRT 1143278-1143309 32 NC_028662 Mycobacterium phage Phlei, complete genome 44891-44922 5 0.844
CP027586_1 1.1|1142973|32|CP027586|PILER-CR,CRISPRCasFinder,CRT 1142973-1143004 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027586_1 1.2|1143034|32|CP027586|PILER-CR,CRISPRCasFinder,CRT 1143034-1143065 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
CP027586_1 1.3|1143095|32|CP027586|PILER-CR,CRISPRCasFinder,CRT 1143095-1143126 32 NC_021529 Vibrio phage nt-1, complete genome 92167-92198 7 0.781
CP027586_1 1.2|1143034|32|CP027586|PILER-CR,CRISPRCasFinder,CRT 1143034-1143065 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
CP027586_1 1.2|1143034|32|CP027586|PILER-CR,CRISPRCasFinder,CRT 1143034-1143065 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
CP027586_1 1.3|1143095|32|CP027586|PILER-CR,CRISPRCasFinder,CRT 1143095-1143126 32 NZ_CP015355 Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence 26849-26880 9 0.719

1. spacer 1.6|1143278|32|CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NC_028662 (Mycobacterium phage Phlei, complete genome) position: , mismatch: 5, identity: 0.844 

-gaggtggcaatacgcgtagatcatttggtcgt	CRISPR spacer
agagctcgc-atacgcgtagagcgtttggtcgt	Protospacer
 *** * ** *********** *.*********

2. spacer 1.1|1142973|32|CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 1.2|1143034|32|CP027586|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga	Protospacer
.** ******** **************..**

4. spacer 1.3|1143095|32|CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 7, identity: 0.781 

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
gtcaacataatgagcaaaatcaacgtctctgt	Protospacer
* ********.**.*************  . *

5. spacer 1.2|1143034|32|CP027586|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg	Protospacer
.***** ****************** .  .*

6. spacer 1.2|1143034|32|CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgcgcgtaccggatcgcggacaacaaattgc------	CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg	Protospacer
 ****** ************ ***      **

7. spacer 1.3|1143095|32|CP027586|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015355 (Bacillus thuringiensis strain MYBT18246 plasmid p109822, complete sequence) position: , mismatch: 9, identity: 0.719 

ggcaacataacgaacaaaatcaacgtcaacct	CRISPR spacer
tgcaacagaaccaacaaaatcaacattatatc	Protospacer
 ****** *** ************.*.*  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage