1. spacer 3.1|1535238|40|CP027312|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 1.1|774990|38|CP027312|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
3. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 5, identity: 0.839
caccgttttcgcccaccagggcgcacaaccc- CRISPR spacer
caccgttctcgcccaacagggcg-acaatctc Protospacer
*******.******* ******* ****.*.
4. spacer 7.13|4789545|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 6, identity: 0.812
attcttgatcacgcttttaccgaagt--aatggt CRISPR spacer
attgttgatcacgcttttactgaagttcgacg-- Protospacer
*** ****************.***** .*.*
5. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812
ccaccgttttcgcccaccagggcgcacaaccc- CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc Protospacer
*******.******* ******* ****.*.
6. spacer 7.6|4789118|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
-gtctgtgatggcctgctcgtgagtccgcggcg CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct Protospacer
*. ** ************** ***.**** *
7. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
8. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
9. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
10. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
11. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
12. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
13. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
14. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
15. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
ccaccgttttcgcccaccagggcgcacaaccc- CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc Protospacer
*******.****** ********. **. **.
16. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
17. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
18. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
19. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
20. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
21. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
22. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
23. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcttacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
24. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
25. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
26. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
27. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
28. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_020385 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
29. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
30. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
31. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
32. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
33. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
34. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
35. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
36. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
37. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
38. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
39. spacer 7.17|4789789|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.75
agcgtcaatcagcgcgtctatcgcgtcacttt CRISPR spacer
ggcgtcaatgagcgcgtcgatcgcggcgggat Protospacer
.******** ******** ****** *. *
40. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
tcgagcccgatcatcggcatcagcagttccgg Protospacer
.**********.******** ***..* * *.
41. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
tcgaccccgattatcgggatgagctcggcgtg Protospacer
.*** ************ ****** *** .
42. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
caccgttttcgccgatcagggcggtgacctt Protospacer
************* *.******* * *..
43. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 9, identity: 0.719
atccggctatatctttgagcattacagaaata CRISPR spacer
gcctcaatatatcattgagcaatacagaaatt Protospacer
..*. . ****** ******* *********
44. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_019699 (Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence) position: , mismatch: 9, identity: 0.719
cggcgttccgtgcggcaattggaatcacacca CRISPR spacer
agagaatccctgcggcaattggaatcccagcc Protospacer
*. . *** **************** ** *
45. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MK962627 (Achromobacter phage vB_AxyS_19-32_Axy06, complete genome) position: , mismatch: 9, identity: 0.719
cggcgttccgtgcggcaattggaatcacacca CRISPR spacer
cggcgttccgtccggcaactggatgcccttgt Protospacer
*********** ******.**** * * .
46. spacer 7.17|4789789|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agcgtcaatcagcgcgtctatcgcgtcacttt CRISPR spacer
gaactcaatcagcgcgttcatcgcgtcgcgat Protospacer
.. *************..********.* *
47. spacer 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
atttgggggtatgagagcgccgagccgttcgg CRISPR spacer
gtcgaacggtatgcgggcgccgagccgttcga Protospacer
.*. .. ****** *.***************.
48. spacer 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atttgggggtatgagagcgccgagccgttcgg CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt Protospacer
* .* ******* ********.******
49. spacer 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
atttgggggtatgagagcgccgagccgttcgg CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt Protospacer
* .* ******* ********.******
50. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
tgaattaggattatcgacatgagcgatacgga Protospacer
. .* . ********.**********.****
51. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct Protospacer
**********.*********.** .* *
52. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct Protospacer
**********.*********.** .* *
53. spacer 7.22|4790094|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaagaagaaagggaaataatgcgaggaacg CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg Protospacer
.*.**************.** ***** . *
54. spacer 7.24|4790216|32|CP027312|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719
cgcgagagccagcaaaacgccagggcacaaaa CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat Protospacer
*. * ***.************* *****
55. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
56. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
57. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
58. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
59. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
60. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
61. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
62. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
63. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
64. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
65. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
66. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
67. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
68. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
69. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
70. spacer 8.1|4805808|31|CP027312|PILER-CR matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
71. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
72. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.71
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat Protospacer
***. ****************** * .
73. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
74. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
75. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
76. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
77. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt Protospacer
************* *.******* * *..
78. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
79. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
80. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
81. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
82. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
83. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
84. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
85. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
86. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
87. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
88. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
89. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
90. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
91. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat Protospacer
* ***. ****************** * .
92. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta Protospacer
. . ****.*********.******** *
93. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta Protospacer
. . ****.*********.******** *
94. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
95. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
96. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
97. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
98. spacer 7.24|4790216|32|CP027312|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgagagccagcaaaacgccagggcacaaaa CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt Protospacer
* ..***** *****.*********** ..
99. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.677
caccgttttcgcccaccagggcgcacaaccc CRISPR spacer
caccgtattcgccaaccagggcggcagggaa Protospacer
****** ****** ********* ..
100. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccaccgttttcgcccaccagggcgcacaaccc CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa Protospacer
******* ****** ********* ..
101. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000056 (Agrobacterium vitis strain Tun201 plasmid pTi_Tun201, complete sequence) position: , mismatch: 11, identity: 0.656
cggcgttccgtgcggcaattggaatcacacca CRISPR spacer
ttttcttccgtgcggcaattcgtatcacggat Protospacer
. . *************** * *****.
102. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000060 (Agrobacterium tumefaciens strain CFBP2407 plasmid pTi_CFBP2407, complete sequence) position: , mismatch: 11, identity: 0.656
cggcgttccgtgcggcaattggaatcacacca CRISPR spacer
ttttcttccgtgcggcaattcgtatcacggat Protospacer
. . *************** * *****.
