Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027312 Escherichia coli strain 2013C-3181 chromosome, complete genome 8 crisprs NA 3 16 0 0

Results visualization

1. CP027312
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_1 774947-775070 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_2 1409072-1409274 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_3 1535212-1535303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_4 1866386-1866530 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_5 4288244-4288640 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_6 4303211-4303328 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_7 4788784-4790276 Orphan I-E
24 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027312_8 4805778-4805929 Orphan I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP027312_5 5.1|4288301|56|CP027312|PILER-CR 4288301-4288356 56 CP027312.1 4288188-4288243 2 0.964
CP027312_5 5.2|4288414|57|CP027312|PILER-CR 4288414-4288470 57 CP027312.1 4288188-4288244 2 0.965
CP027312_5 5.3|4288528|56|CP027312|PILER-CR 4288528-4288583 56 CP027312.1 4288188-4288243 2 0.964

1. spacer 5.1|4288301|56|CP027312|PILER-CR matches to position: 4288188-4288243, mismatch: 2, identity: 0.964

ggtcagtttcacctggtttacgtaaaaaaccgcttcggcgggtttttgcttttgga	CRISPR spacer
ggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttgga	Protospacer
***************.************ ***************************

2. spacer 5.2|4288414|57|CP027312|PILER-CR matches to position: 4288188-4288244, mismatch: 2, identity: 0.965

ggtcagtttcacctggtttacgtaaaaaaccgcttcggcgggtttttgcttttggag	CRISPR spacer
ggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttggag	Protospacer
***************.************ ****************************

3. spacer 5.3|4288528|56|CP027312|PILER-CR matches to position: 4288188-4288243, mismatch: 2, identity: 0.964

ggtcagtttcacctggtttacgtaaaaaaccgcttcggcgggtttttgcttttgga	CRISPR spacer
ggtcagtttcacctgatttacgtaaaaacccgcttcggcgggtttttgcttttgga	Protospacer
***************.************ ***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027312_3 3.1|1535238|40|CP027312|CRISPRCasFinder 1535238-1535277 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027312_1 1.1|774990|38|CP027312|CRISPRCasFinder 774990-775027 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71973-72003 5 0.839
CP027312_7 7.13|4789545|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789545-4789576 32 MG592456 Vibrio phage 1.081.O._10N.286.52.C2, partial genome 219798-219829 6 0.812
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP019314 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence 71972-72003 6 0.812
CP027312_7 7.6|4789118|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789118-4789149 32 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 555773-555804 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NC_018516 Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence 207611-207642 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NZ_CP053970 Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence 222835-222866 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NZ_CP053979 Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence 131047-131078 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NZ_CP013277 Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence 349369-349400 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NZ_CP039723 Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence 116770-116801 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NZ_CP009348 Bacillus thuringiensis HD1002 plasmid 2, complete sequence 349371-349402 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NZ_CP009334 Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence 141808-141839 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 NZ_CP045024 Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence 348980-349011 7 0.781
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 66681-66712 7 0.781
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 MN434096 Klebsiella phage JIPh_Kp127, complete genome 8414-8445 8 0.75
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 MK630230 Klebsiella phage Spivey, complete genome 1815-1846 8 0.75
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 MN434094 Klebsiella phage AmPh_EK80, complete genome 8419-8450 8 0.75
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 MG459987 Klebsiella phage Sugarland, complete genome 8643-8674 8 0.75
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 MT380195 Klebsiella phage KP_LZD_B01, complete genome 3481-3512 8 0.75
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 8404-8435 8 0.75
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 KX845404 Klebsiella phage vB_Kpn_IME260, complete genome 121617-121648 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 NZ_CP040783 Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence 254266-254297 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 NZ_CP031069 Bacillus sp. JAS24-2 plasmid pl626, complete sequence 402616-402647 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 NZ_CP053952 Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence 15995-16026 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 CP020755 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence 160650-160681 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 NZ_CP011156 Bacillus cereus strain HN001 plasmid pRML01, complete sequence 58852-58883 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 NC_020385 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence 58853-58884 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 NZ_CP021062 Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence 376005-376036 8 0.75
CP027312_7 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789423-4789454 32 NZ_CP053949 Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence 146145-146176 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NC_010180 Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence 223698-223729 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NZ_CP015592 Bacillus cereus strain AR156 plasmid pAR460, complete sequence 221508-221539 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 147474-147505 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NZ_CP040345 Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence 374123-374154 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NZ_CP009368 Bacillus cereus strain FM1 plasmid unnamed, complete sequence 74049-74080 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 130803-130834 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NZ_CP009336 Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence 195225-195256 8 0.75
CP027312_7 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789728-4789759 32 NZ_CP053657 Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence 471476-471507 8 0.75
CP027312_7 7.17|4789789|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789789-4789820 32 NZ_AP012556 Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence 152763-152794 8 0.75
CP027312_7 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790033-4790064 32 NZ_CP038236 Leisingera sp. NJS201 plasmid unnamed2, complete sequence 2813-2844 8 0.75
CP027312_7 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790033-4790064 32 NZ_CP016463 Bosea sp. RAC05 plasmid pBSY19_1, complete sequence 353558-353589 8 0.75
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166141-166171 8 0.742
CP027312_7 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789362-4789393 32 HQ615693 Synechococcus phage S-CRM01, complete genome 2748-2779 9 0.719
CP027312_7 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789667-4789698 32 NC_019699 Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence 59399-59430 9 0.719
CP027312_7 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789667-4789698 32 MK962627 Achromobacter phage vB_AxyS_19-32_Axy06, complete genome 21335-21366 9 0.719
CP027312_7 7.17|4789789|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789789-4789820 32 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 161129-161160 9 0.719
CP027312_7 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789850-4789881 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 5210759-5210790 9 0.719
CP027312_7 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789850-4789881 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 191956-191987 9 0.719
CP027312_7 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789850-4789881 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1498191-1498222 9 0.719
CP027312_7 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790033-4790064 32 NZ_CP013541 Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence 1036450-1036481 9 0.719
CP027312_7 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790033-4790064 32 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 1555010-1555041 9 0.719
CP027312_7 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790033-4790064 32 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 619383-619414 9 0.719
CP027312_7 7.22|4790094|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790094-4790125 32 NC_017140 Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence 5097-5128 9 0.719
CP027312_7 7.24|4790216|32|CP027312|CRISPRCasFinder,CRT 4790216-4790247 32 MK249151 Blackfly microvirus SF02 isolate 049, complete genome 1908-1939 9 0.719
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46037 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125807 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134685 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68754 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103194 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125416 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36045 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125807 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103115 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103194 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103193 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125416 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103191 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103191 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103115 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92331 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100893 9 0.71
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97249-97279 9 0.71
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP020898 Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence 46007-46038 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013555 Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence 125777-125808 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP020950 Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence 134655-134686 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013587 Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence 68724-68755 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 166140-166171 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013598 Rhizobium sp. N741 plasmid pRspN741c, complete sequence 103164-103195 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013578 Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013544 Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence 36015-36046 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013566 Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence 125777-125808 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013502 Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence 103085-103116 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013508 Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence 103164-103195 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013519 Rhizobium sp. N113 plasmid pRspN113b, complete sequence 103163-103194 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013572 Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence 125386-125417 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013492 Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence 103161-103192 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013497 Rhizobium sp. N621 plasmid pRspN621b, complete sequence 103161-103192 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP013592 Rhizobium sp. N871 plasmid pRspN871b, complete sequence 103085-103116 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 CP007643 Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence 92301-92332 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NC_010996 Rhizobium etli CIAT 652 plasmid pB, complete sequence 100863-100894 9 0.719
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP034999 Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence 97248-97279 9 0.719
CP027312_7 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790033-4790064 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 823434-823465 10 0.688
CP027312_7 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790033-4790064 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 682589-682620 10 0.688
CP027312_7 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790155-4790186 32 NZ_CP039902 Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence 33041-33072 10 0.688
CP027312_7 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790155-4790186 32 NZ_CP039893 Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence 217865-217896 10 0.688
CP027312_7 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790155-4790186 32 NZ_KY000025 Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence 208000-208031 10 0.688
CP027312_7 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4790155-4790186 32 NZ_KY000029 Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence 208000-208031 10 0.688
CP027312_7 7.24|4790216|32|CP027312|CRISPRCasFinder,CRT 4790216-4790247 32 NZ_CP038854 Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence 450688-450719 10 0.688
CP027312_8 8.1|4805808|31|CP027312|PILER-CR 4805808-4805838 31 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679276 10 0.677
CP027312_8 8.3|4805807|32|CP027312|CRISPRCasFinder 4805807-4805838 32 NZ_CP040452 Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence 1679246-1679277 10 0.688
CP027312_7 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789667-4789698 32 NZ_KY000056 Agrobacterium vitis strain Tun201 plasmid pTi_Tun201, complete sequence 141208-141239 11 0.656
CP027312_7 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT 4789667-4789698 32 NZ_KY000060 Agrobacterium tumefaciens strain CFBP2407 plasmid pTi_CFBP2407, complete sequence 186805-186836 11 0.656

1. spacer 3.1|1535238|40|CP027312|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 1.1|774990|38|CP027312|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 5, identity: 0.839

caccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
caccgttctcgcccaacagggcg-acaatctc	Protospacer
*******.******* ******* ****.*. 

4. spacer 7.13|4789545|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 6, identity: 0.812

attcttgatcacgcttttaccgaagt--aatggt	CRISPR spacer
attgttgatcacgcttttactgaagttcgacg--	Protospacer
*** ****************.*****  .*.*  

5. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP019314 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-2, complete sequence) position: , mismatch: 6, identity: 0.812

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
gcaccgttctcgcccaacagggcg-acaatctc	Protospacer
 *******.******* ******* ****.*. 

6. spacer 7.6|4789118|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

-gtctgtgatggcctgctcgtgagtccgcggcg	CRISPR spacer
cgcgtg-gatggcctgctcgtcagttcgcgcct	Protospacer
 *. ** ************** ***.**** * 

7. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

8. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

9. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

10. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

11. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

12. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

13. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

14. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

atccggctatatctttgagcattacagaaata	CRISPR spacer
ttatagctatatctttgtgcattagagaaatc	Protospacer
 * ..************ ****** ****** 

15. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781

ccaccgttttcgcccaccagggcgcacaaccc-	CRISPR spacer
ccaccgtcttcgccgaccagggca-acgtcctc	Protospacer
*******.****** ********. **. **. 

16. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

17. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

18. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

19. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

20. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

21. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

22. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75

atccggctatatctttgagcattacagaaata	CRISPR spacer
atccggctatgcctttgagcattgccgtgact	Protospacer
**********..***********.* * .*. 

23. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcttacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

24. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

25. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

26. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

27. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

28. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_020385 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

29. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

30. spacer 7.11|4789423|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ctattgctttcgtacagattttcagtggtgct	CRISPR spacer
tatttgctttcctacagattttctgtcttgtt	Protospacer
.  ******** *********** **  **.*

31. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

32. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

33. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

34. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

35. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

36. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

37. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

38. spacer 7.16|4789728|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.75

cgttctg---aatccgatattcttcagcaccttca	CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct	Protospacer
   **..   ***************  ******* 

39. spacer 7.17|4789789|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.75

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
ggcgtcaatgagcgcgtcgatcgcggcgggat	Protospacer
.******** ******** ****** *.   *

40. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgagcccgatcatcggcatcagcagttccgg	Protospacer
.**********.******** ***..* * *.

41. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tcgaccccgattatcgggatgagctcggcgtg	Protospacer
.*** ************ ******   *** .

42. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
caccgttttcgccgatcagggcggtgacctt	Protospacer
************* *.*******   * *..

43. spacer 7.10|4789362|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 9, identity: 0.719

atccggctatatctttgagcattacagaaata	CRISPR spacer
gcctcaatatatcattgagcaatacagaaatt	Protospacer
..*. . ****** ******* ********* 

44. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_019699 (Chroococcidiopsis thermalis PCC 7203 plasmid pCHRO.01, complete sequence) position: , mismatch: 9, identity: 0.719

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
agagaatccctgcggcaattggaatcccagcc	Protospacer
 *. . *** **************** ** * 

45. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to MK962627 (Achromobacter phage vB_AxyS_19-32_Axy06, complete genome) position: , mismatch: 9, identity: 0.719

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
cggcgttccgtccggcaactggatgcccttgt	Protospacer
*********** ******.****  * * .  

46. spacer 7.17|4789789|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

agcgtcaatcagcgcgtctatcgcgtcacttt	CRISPR spacer
gaactcaatcagcgcgttcatcgcgtcgcgat	Protospacer
..  *************..********.*  *

47. spacer 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
gtcgaacggtatgcgggcgccgagccgttcga	Protospacer
.*. .. ****** *.***************.

48. spacer 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.****** 

49. spacer 7.18|4789850|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719

atttgggggtatgagagcgccgagccgttcgg	CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt	Protospacer
*  .*   ******* ********.****** 

50. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
tgaattaggattatcgacatgagcgatacgga	Protospacer
. .* .  ********.**********.****

51. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *  

52. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct	Protospacer
 **********.*********.**  .* *  

53. spacer 7.22|4790094|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_017140 (Bacillus megaterium WSH-002 plasmid WSH-002_p2, complete sequence) position: , mismatch: 9, identity: 0.719

tcgaagaagaaagggaaataatgcgaggaacg	CRISPR spacer
atggagaagaaagggaaacaaagcgagcgcgg	Protospacer
 .*.**************.** ***** .  *

54. spacer 7.24|4790216|32|CP027312|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat	Protospacer
  *. *  ***.************* ***** 

55. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

56. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

57. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

58. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

59. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

60. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

61. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

62. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

63. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

64. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

65. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

66. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

67. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

68. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

69. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

70. spacer 8.1|4805808|31|CP027312|PILER-CR matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

71. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

72. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.71

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gtccgcgttcgcccaccagggcgcagacgat	Protospacer
  ***. ****************** *   .

73. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP020898 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRetBra5b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

74. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

75. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

76. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

77. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
gcaccgttttcgccgatcagggcggtgacctt	Protospacer
 ************* *.*******   * *..

78. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

79. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

80. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

81. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

82. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

83. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

84. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

85. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

86. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

87. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

88. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

89. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to CP007643 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803b, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

90. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

91. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP034999 (Rhizobium acidisoli strain FH23 plasmid pRapFH23a, complete sequence) position: , mismatch: 9, identity: 0.719

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
cgtccgcgttcgcccaccagggcgcagacgat	Protospacer
*  ***. ****************** *   .

92. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

93. spacer 7.21|4790033|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688

ccgagcccgattatcggcatgagcgatgcgga	CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta	Protospacer
 . .   ****.*********.******** *

94. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

95. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

96. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

97. spacer 7.23|4790155|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688

tattacgcgccagcaatgctgacagcggcaaa	CRISPR spacer
agcatggcgccagcaatggcgacagcggccag	Protospacer
 ..   ************ .********* *.

98. spacer 7.24|4790216|32|CP027312|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgcgagagccagcaaaacgccagggcacaaaa	CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt	Protospacer
 * ..***** *****.*********** .. 

99. spacer 8.1|4805808|31|CP027312|PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.677

caccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
caccgtattcgccaaccagggcggcagggaa	Protospacer
****** ****** *********   ..   

100. spacer 8.3|4805807|32|CP027312|CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccaccgttttcgcccaccagggcgcacaaccc	CRISPR spacer
ccaccgtattcgccaaccagggcggcagggaa	Protospacer
******* ****** *********   ..   

101. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000056 (Agrobacterium vitis strain Tun201 plasmid pTi_Tun201, complete sequence) position: , mismatch: 11, identity: 0.656

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
ttttcttccgtgcggcaattcgtatcacggat	Protospacer
.  . *************** * *****.   

102. spacer 7.15|4789667|32|CP027312|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000060 (Agrobacterium tumefaciens strain CFBP2407 plasmid pTi_CFBP2407, complete sequence) position: , mismatch: 11, identity: 0.656

cggcgttccgtgcggcaattggaatcacacca	CRISPR spacer
ttttcttccgtgcggcaattcgtatcacggat	Protospacer
.  . *************** * *****.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage