CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number	Prophage number	Anti-CRISPR protein number
CP027350	Escherichia coli strain 2014C-3655 plasmid unnamed	0 crisprs	NA	0	0	0	0
CP027351	Escherichia coli strain 2014C-3655 chromosome, complete genome	2 crisprs	NA	0	8	0	0

Results visualization

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP027351_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP027351_1

4693017-4693290

Orphan

I-E

Consensus_repeat	Method
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	CRISPRCasFinder
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	CRT
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	PILER-CR

4 spacers

The CRISPR arrays of CP027351_1

>merge|CP027351|1|4693017-4693290|CRISPRCasFinder,CRT,PILER-CR
CCGGTTTATCCCCGCTGGCGCGGGGAACACTCACGCGCTGTTACCCAGTCCCTTTTTTTCAGCGGTTTATCCCCGCTGGCGCGGGGAACACTACAGGAAAGAATCCGCCAACGGCGACAGGGGCGGTTTATCCCCGCTGGCGCGGGGAACACGAATATCCACCCGTCCTGTATTCCGCCAATTGCGGTTTATCCCCGCTGGCGCGGGGAACACTACCAAACCGGAATCTTTCCATATAACGGCGGCGGTTTATCCCCGCTGGCGCGGGGAACAC

>CP027351|1|1|4693017-4693290|CRISPRCasFinder
CCGGTTTATCCCCGCTGGCGCGGGGAACAC	TCACGCGCTGTTACCCAGTCCCTTTTTTTCA
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	TACAGGAAAGAATCCGCCAACGGCGACAGGG
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	GAATATCCACCCGTCCTGTATTCCGCCAATT
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	TACCAAACCGGAATCTTTCCATATAACGGCG
GCGGTTTATCCCCGCTGGCGCGGGGAACAC

>CP027351|1|1|4693017-4693290|CRT
CCGGTTTATCCCCGCTGGCGCGGGGAACAC	TCACGCGCTGTTACCCAGTCCCTTTTTTTCA
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	TACAGGAAAGAATCCGCCAACGGCGACAGGG
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	GAATATCCACCCGTCCTGTATTCCGCCAATT
GCGGTTTATCCCCGCTGGCGCGGGGAACAC	TACCAAACCGGAATCTTTCCATATAACGGCG
GCGGTTTATCCCCGCTGGCGCGGGGAACAC

>CP027351|1|1|4693018-4693290|PILER-CR
CGGTTTATCCCCGCTGGCGCGGGGAACACT	CACGCGCTGTTACCCAGTCCCTTTTTTTCAG
CGGTTTATCCCCGCTGGCGCGGGGAACACT	ACAGGAAAGAATCCGCCAACGGCGACAGGGG
CGGTTTATCCCCGCTGGCGCGGGGAACACG	AATATCCACCCGTCCTGTATTCCGCCAATTG
CGGTTTATCCCCGCTGGCGCGGGGAACACT	ACCAAACCGGAATCTTTCCATATAACGGCGG
CGGTTTATCCCCGCTGGCGCGGGGAACAC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP027351_2

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP027351_2

4720303-4720637

Orphan

I-E

Consensus_repeat	Method
CGGTTTATCCCCGCTGGCGCGGGGAACTC	CRT
GGTTTATCCCCGCTGGCGCGGGGAACTC	CRISPRCasFinder
CGCCGGTTTATCCCCGCTGGCGCGGGGAACTCT	PILER-CR

5 spacers

The CRISPR arrays of CP027351_2

>merge|CP027351|2|4720303-4720637|CRT,CRISPRCasFinder,PILER-CR
TGGTTTATCCCCGCTGGCGCGGGGAACTCATATACAGCAAACCTTCAGAATGCATTCCGGACGGTTTATCCCCGCTGGCGCGGGGAACTCGTGACCGTCGGTGTTACGCTGAACTGCTGAAACGGTTTATCCCCGCTGGCGCGGGGAACTCAATATTTGCAACACCCGCAAGAACATCAACGCCGGTTTATCCCCGCTGGCGCGGGGAACTCTTGCATCATTTTTGTACACGTCGAGCTTCCCCCGGTTTATCCCCGCTAGCGCGGGGAACTCCGCGTTGAAAGCGCGAGCGCGTTAGCTGACGACGGTTTATCCCCGCTGGCGCGGGGAACTCT

>CP027351|2|2|4720303-4720636|CRT
TGGTTTATCCCCGCTGGCGCGGGGAACTC	ATATACAGCAAACCTTCAGAATGCATTCCGGA
CGGTTTATCCCCGCTGGCGCGGGGAACTC	GTGACCGTCGGTGTTACGCTGAACTGCTGAAA
CGGTTTATCCCCGCTGGCGCGGGGAACTC	AATATTTGCAACACCCGCAAGAACATCAACGC
CGGTTTATCCCCGCTGGCGCGGGGAACTC	TTGCATCATTTTTGTACACGTCGAGCTTCCCC
CGGTTTATCCCCGCTAGCGCGGGGAACTC	CGCGTTGAAAGCGCGAGCGCGTTAGCTGACGA
CGGTTTATCCCCGCTGGCGCGGGGAACTC

>CP027351|2|2|4720304-4720636|CRISPRCasFinder
GGTTTATCCCCGCTGGCGCGGGGAACTC	ATATACAGCAAACCTTCAGAATGCATTCCGGAC
GGTTTATCCCCGCTGGCGCGGGGAACTC	GTGACCGTCGGTGTTACGCTGAACTGCTGAAAC
GGTTTATCCCCGCTGGCGCGGGGAACTC	AATATTTGCAACACCCGCAAGAACATCAACGCC
GGTTTATCCCCGCTGGCGCGGGGAACTC	TTGCATCATTTTTGTACACGTCGAGCTTCCCCC
GGTTTATCCCCGCTAGCGCGGGGAACTC	CGCGTTGAAAGCGCGAGCGCGTTAGCTGACGAC
GGTTTATCCCCGCTGGCGCGGGGAACTC

>CP027351|2|2|4720483-4720637|PILER-CR
CGCCGGTTTATCCCCGCTGGCGCGGGGAACTCT	TGCATCATTTTTGTACACGTCGAGCTTC
CCCCGGTTTATCCCCGCTAGCGCGGGGAACTCC	GCGTTGAAAGCGCGAGCGCGTTAGCTGA
CGACGGTTTATCCCCGCTGGCGCGGGGAACTCT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP027351_2	2.2\|4720393\|32\|CP027351\|CRT	4720393-4720424	32	CP054922	Streptomyces sp. NA03103 plasmid unnamed2, complete sequence	68158-68189	6	0.812
CP027351_2	2.3\|4720454\|32\|CP027351\|CRT	4720454-4720485	32	MH389777	Dickeya phage vB_DsoM_JA11, complete genome	116689-116720	6	0.812
CP027351_2	2.3\|4720454\|32\|CP027351\|CRT	4720454-4720485	32	MH460462	Dickeya phage vB_DsoM_JA33, complete genome	116679-116710	6	0.812
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_AP022602	Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399	61999-62029	7	0.774
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_AP022602	Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399	61999-62029	7	0.774
CP027351_2	2.8\|4720454\|33\|CP027351\|CRISPRCasFinder	4720454-4720486	33	MH389777	Dickeya phage vB_DsoM_JA11, complete genome	116689-116721	7	0.788
CP027351_2	2.8\|4720454\|33\|CP027351\|CRISPRCasFinder	4720454-4720486	33	MH460462	Dickeya phage vB_DsoM_JA33, complete genome	116679-116711	7	0.788
CP027351_1	1.1\|4693047\|31\|CP027351\|CRISPRCasFinder,CRT	4693047-4693077	31	NZ_CP026601	Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence	97057-97087	8	0.742
CP027351_1	1.5\|4693048\|31\|CP027351\|PILER-CR	4693048-4693078	31	NZ_CP026601	Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence	97057-97087	8	0.742
CP027351_2	2.12\|4720577\|28\|CP027351\|PILER-CR	4720577-4720604	28	HG796329	Uncultured bacterium plasmid pRGI00478	3104-3131	8	0.714
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	168728-168758	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP009883	Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence	5480-5510	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	100872-100902	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP026171	Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence	69668-69698	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP026196	Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence	140212-140242	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_AP021845	Azospira sp. I09 plasmid pAZI09, complete sequence	335649-335679	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	51817-51847	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP042479	Citrobacter freundii strain C50 plasmid pC50_001, complete sequence	136820-136850	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP026208	Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence	50052-50082	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP032179	Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence	65507-65537	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP026391	Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence	6461-6491	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP029142	Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence	256680-256710	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	47915-47945	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP011635	Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence	9471-9501	9	0.71
CP027351_1	1.2\|4693108\|31\|CP027351\|CRISPRCasFinder,CRT	4693108-4693138	31	NZ_CP044111	Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2	384418-384448	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP026242	Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence	168728-168758	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP009883	Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence	5480-5510	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP010380	Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence	100872-100902	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP026171	Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence	69668-69698	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP026196	Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence	140212-140242	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_AP021845	Azospira sp. I09 plasmid pAZI09, complete sequence	335649-335679	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	CP009869	Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence	51817-51847	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP042479	Citrobacter freundii strain C50 plasmid pC50_001, complete sequence	136820-136850	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP026208	Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence	50052-50082	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP032179	Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence	65507-65537	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP026391	Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence	6461-6491	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP029142	Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence	256680-256710	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP031135	Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence	47915-47945	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP011635	Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence	9471-9501	9	0.71
CP027351_1	1.6\|4693109\|31\|CP027351\|PILER-CR	4693109-4693139	31	NZ_CP044111	Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2	384418-384448	9	0.71
CP027351_2	2.3\|4720454\|32\|CP027351\|CRT	4720454-4720485	32	NZ_CP039965	Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence	712830-712861	9	0.719

1. spacer 2.2|4720393|32|CP027351|CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

gtgaccgtcggtgttacgctgaactgctgaaa--	CRISPR spacer
gtgaccgtcggtgttccggtgaa--gcggaaggc	Protospacer
*************** ** ****  ** ***.

2. spacer 2.3|4720454|32|CP027351|CRT matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 6, identity: 0.812

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

3. spacer 2.3|4720454|32|CP027351|CRT matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 6, identity: 0.812

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

4. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 7, identity: 0.774

tacaggaa---agaatccgccaacggcgacaggg	CRISPR spacer
---atgcacccagaatccgccaccggcgaccggg	Protospacer
   * * *   *********** ******* ***

5. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 7, identity: 0.774

tacaggaa---agaatccgccaacggcgacaggg	CRISPR spacer
---atgcacccagaatccgccaccggcgaccggg	Protospacer
   * * *   *********** ******* ***

6. spacer 2.8|4720454|33|CP027351|CRISPRCasFinder matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 7, identity: 0.788

aatatttgcaacacccgcaagaacatcaacgcc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgct	Protospacer
  **..*********.***** **********.

7. spacer 2.8|4720454|33|CP027351|CRISPRCasFinder matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 7, identity: 0.788

aatatttgcaacacccgcaagaacatcaacgcc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgct	Protospacer
  **..*********.***** **********.

8. spacer 1.1|4693047|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tcacgcgctgttacccagtccctttttttca	CRISPR spacer
tcttataatgttatccagtacctttttttca	Protospacer
** .... *****.***** ***********

9. spacer 1.5|4693048|31|CP027351|PILER-CR matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

tcacgcgctgttacccagtccctttttttca	CRISPR spacer
tcttataatgttatccagtacctttttttca	Protospacer
** .... *****.***** ***********

10. spacer 2.12|4720577|28|CP027351|PILER-CR matches to HG796329 (Uncultured bacterium plasmid pRGI00478) position: , mismatch: 8, identity: 0.714

gcgttgaaagcgcgagcgcgttagctga	CRISPR spacer
tttcaacaagcgcaagcgcgttagctga	Protospacer
 . . . ******.**************

11. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

12. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

13. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

14. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

15. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

16. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

17. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

18. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP042479 (Citrobacter freundii strain C50 plasmid pC50_001, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

19. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

20. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

21. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

22. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

23. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

24. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

25. spacer 1.2|4693108|31|CP027351|CRISPRCasFinder,CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

26. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

27. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

28. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

29. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

30. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

31. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

32. spacer 1.6|4693109|31|CP027351|PILER-CR matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

33. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP042479 (Citrobacter freundii strain C50 plasmid pC50_001, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

34. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

35. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

36. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

37. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

38. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

39. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

40. spacer 1.6|4693109|31|CP027351|PILER-CR matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

tacaggaaagaatccgccaacggcgacaggg	CRISPR spacer
gcgaggaaagaagccgccgacggcgaggacg	Protospacer
   ********* *****.******* .. *

41. spacer 2.3|4720454|32|CP027351|CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
agccagttcagcaccagcaagaacatcaacga	Protospacer
*..   * **.**** ***************

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

Overview of predicted results

Overview of the results

Cas Category Instructions

Results visualization

1. CP027351

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection