1. spacer 1.1|932150|40|CP027352|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 2.1|2535621|32|CP027352|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906
taagtgatatccatcatcgcatccagtgcgcc CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc Protospacer
.*******.*********************.*
3. spacer 2.2|2535682|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
aaaaccaaacttctccataaattccatagccg CRISPR spacer
attactaaacttctgcataaattccataggag Protospacer
* **.******** ************** *
4. spacer 2.1|2535621|32|CP027352|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781
taagtgat-atccatcatcgcatccagtgcgcc CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc Protospacer
.. **** .*** ******** **********
5. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc Protospacer
*** . * .****** ******** *******
6. spacer 2.1|2535621|32|CP027352|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
taagtg---atatccatcatcgcatccagtgcgcc CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc Protospacer
*** . *******.*** ***********
7. spacer 2.6|2535926|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75
tcttcgcgggtaatcaatgatgattcagtttc CRISPR spacer
tcttcgcggataatcaaagatgatcgtgaatt Protospacer
*********.******* ******. * *.
8. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac Protospacer
..* .***** **** ************* *
9. spacer 3.2|2561960|32|CP027352|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75
-gacagaacggcctcagtagtctcgtcaggctc CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt Protospacer
** * .****.******.***********.
10. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggtgctgtcgggagcggggaggatgagagaat Protospacer
. *.******* *** ***********...**
11. spacer 2.1|2535621|32|CP027352|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
taagtgatatccatcatcgcatccagtgcgcc CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc Protospacer
. .* ..*********** ***********
12. spacer 2.4|2535804|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
gagagtgctgacaggtgtctcgattacctgat CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg Protospacer
*. *****.***** ************ .
13. spacer 2.7|2535987|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgcaatatcacggcgttctgcggcctcgg CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc Protospacer
. ****************.* **** .**
14. spacer 2.7|2535987|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719
gaacgcaatatcacggcgttctgcggcctcgg CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc Protospacer
. ****.************* **** .**
15. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc Protospacer
*. ..****** ************** **
16. spacer 3.4|2562082|32|CP027352|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ggcatagccaggctgatccggcgacggcctta CRISPR spacer
gcagcagaccggctgatccggcgacggccccg Protospacer
* ..** * *******************...
17. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
18. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
19. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
20. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
21. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
22. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
23. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
24. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
25. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
26. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
27. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
28. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
29. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
30. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
31. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719
actactgtcggtagctgggaggatgaggagat CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat Protospacer
. ..******* *** ***********...**
32. spacer 2.6|2535926|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688
tcttcgcgggtaatcaatgatgattcagtttc CRISPR spacer
cagttgcaggtaatcaatgatgatgcagccca Protospacer
. *.**.**************** ***...
33. spacer 2.8|2536048|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
caaaatattacgagcttcgtcaggccatggac CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgc Protospacer
. ..**.*************** **** .*
34. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688
aacatcggaaacggcttcgcggcggcggcgtc CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa Protospacer
.* . *****.********* *******
35. spacer 2.8|2536048|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
caaaatattacgagcttcgtcaggccatggac CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgg Protospacer
. ..**.*************** **** .
