Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027352 Escherichia coli strain 2012C-4606 chromosome, complete genome 3 crisprs NA 0 11 0 0
CP027354 Escherichia coli strain 2012C-4606 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP027353 Escherichia coli strain 2012C-4606 plasmid unnamed1 0 crisprs NA 0 0 0 0

Results visualization

1. CP027352
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027352_1 932124-932215 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027352_2 2535592-2536169 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027352_3 2561870-2562447 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027352_1 1.1|932150|40|CP027352|CRISPRCasFinder 932150-932189 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027352_2 2.1|2535621|32|CP027352|CRT 2535621-2535652 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP027352_2 2.2|2535682|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2535682-2535713 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027352_2 2.1|2535621|32|CP027352|CRT 2535621-2535652 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP027352_3 3.1|2561899|32|CP027352|CRISPRCasFinder 2561899-2561930 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP027352_2 2.1|2535621|32|CP027352|CRT 2535621-2535652 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP027352_2 2.6|2535926|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2535926-2535957 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 141173-141204 8 0.75
CP027352_3 3.1|2561899|32|CP027352|CRISPRCasFinder 2561899-2561930 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP027352_3 3.2|2561960|32|CP027352|CRISPRCasFinder 2561960-2561991 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
CP027352_2 2.1|2535621|32|CP027352|CRT 2535621-2535652 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP027352_2 2.4|2535804|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2535804-2535835 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP027352_2 2.7|2535987|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2535987-2536018 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP027352_2 2.7|2535987|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2535987-2536018 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
CP027352_3 3.1|2561899|32|CP027352|CRISPRCasFinder 2561899-2561930 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP027352_3 3.4|2562082|32|CP027352|CRISPRCasFinder 2562082-2562113 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
CP027352_3 3.9|2562387|32|CP027352|CRISPRCasFinder 2562387-2562418 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
CP027352_2 2.6|2535926|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2535926-2535957 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 39822-39853 10 0.688
CP027352_2 2.8|2536048|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2536048-2536079 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 903982-904013 10 0.688
CP027352_3 3.1|2561899|32|CP027352|CRISPRCasFinder 2561899-2561930 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
CP027352_2 2.8|2536048|32|CP027352|CRT,PILER-CR,CRISPRCasFinder 2536048-2536079 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1467285-1467316 11 0.656

1. spacer 1.1|932150|40|CP027352|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 2.1|2535621|32|CP027352|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

3. spacer 2.2|2535682|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

4. spacer 2.1|2535621|32|CP027352|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

5. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

6. spacer 2.1|2535621|32|CP027352|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

7. spacer 2.6|2535926|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75

tcttcgcgggtaatcaatgatgattcagtttc	CRISPR spacer
tcttcgcggataatcaaagatgatcgtgaatt	Protospacer
*********.******* ******.  *  *.

8. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

9. spacer 3.2|2561960|32|CP027352|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

10. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggtgctgtcgggagcggggaggatgagagaat	Protospacer
. *.******* *** ***********...**

11. spacer 2.1|2535621|32|CP027352|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

12. spacer 2.4|2535804|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ . 

13. spacer 2.7|2535987|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .** 

14. spacer 2.7|2535987|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .** 

15. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

16. spacer 3.4|2562082|32|CP027352|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ggcatagccaggctgatccggcgacggcctta	CRISPR spacer
gcagcagaccggctgatccggcgacggccccg	Protospacer
*  ..** * *******************...

17. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

18. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

19. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

20. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

21. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

22. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

23. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

24. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

25. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

26. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

27. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

28. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

29. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

30. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

31. spacer 3.9|2562387|32|CP027352|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

32. spacer 2.6|2535926|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688

tcttcgcgggtaatcaatgatgattcagtttc	CRISPR spacer
cagttgcaggtaatcaatgatgatgcagccca	Protospacer
.  *.**.**************** ***... 

33. spacer 2.8|2536048|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688

caaaatattacgagcttcgtcaggccatggac	CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgc	Protospacer
.   ..**.*************** **** .*

34. spacer 3.1|2561899|32|CP027352|CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******    

35. spacer 2.8|2536048|32|CP027352|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656

caaaatattacgagcttcgtcaggccatggac	CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgg	Protospacer
.   ..**.*************** **** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage