Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027358 Escherichia coli strain 2013C-4991 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP027356 Escherichia coli strain 2013C-4991 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP027357 Escherichia coli strain 2013C-4991 plasmid unnamed2 0 crisprs NA 0 0 0 0
CP027355 Escherichia coli strain 2013C-4991 chromosome, complete genome 8 crisprs NA 0 21 0 0

Results visualization

1. CP027355
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_1 93659-93776 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_2 852694-852817 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_3 1775362-1775453 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_4 2139990-2140134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_5 2389741-2389837 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_6 2912367-2912508 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_7 4910206-4910722 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027355_8 4936271-4937214 Orphan I-E
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027355_3 3.1|1775388|40|CP027355|CRISPRCasFinder 1775388-1775427 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027355_8 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936727-4936758 32 NZ_CP042584 Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence 74762-74793 0 1.0
CP027355_8 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT 4937154-4937185 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 1 0.969
CP027355_2 2.1|852737|38|CP027355|CRISPRCasFinder 852737-852774 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027355_7 7.12|4910418|32|CP027355|CRT 4910418-4910449 32 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3605 3 0.906
CP027355_7 7.12|4910418|32|CP027355|CRT 4910418-4910449 32 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3598 3 0.906
CP027355_7 7.12|4910418|32|CP027355|CRT 4910418-4910449 32 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21074 3 0.906
CP027355_7 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder 4910417-4910449 33 NZ_LR134258 Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence 3574-3606 4 0.879
CP027355_7 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder 4910417-4910449 33 LR134281 Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6 3567-3599 4 0.879
CP027355_7 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder 4910417-4910449 33 KY271401 Klebsiella phage 1 LV-2017, complete genome 21043-21075 4 0.879
CP027355_8 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936910-4936941 32 MF547662 Clostridioides phage LIBA6276, complete genome 37369-37400 4 0.875
CP027355_8 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936910-4936941 32 MF547663 Clostridioides phage LIBA2945, complete genome 37369-37400 4 0.875
CP027355_7 7.12|4910418|32|CP027355|CRT 4910418-4910449 32 KY653119 Morganella phage IME1369_02, complete genome 18217-18248 5 0.844
CP027355_8 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936727-4936758 32 NC_014108 Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_B, complete sequence 6021-6052 5 0.844
CP027355_8 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936727-4936758 32 NZ_CP030922 Escherichia coli strain KL53 plasmid pKL53-S, complete sequence 5379-5410 5 0.844
CP027355_8 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936727-4936758 32 NZ_CP038659 Citrobacter freundii strain 680 plasmid p680_1, complete sequence 372822-372853 5 0.844
CP027355_8 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936727-4936758 32 MN699848 Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence 37054-37085 5 0.844
CP027355_8 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936910-4936941 32 NZ_CP029155 Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence 83504-83535 5 0.844
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24789-24826 6 0.842
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24902-24939 6 0.842
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4073-4110 6 0.842
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4072-4109 6 0.842
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4072-4109 6 0.842
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4072-4109 6 0.842
CP027355_7 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder 4910417-4910449 33 KY653119 Morganella phage IME1369_02, complete genome 18216-18248 6 0.818
CP027355_8 8.4|4936483|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936483-4936514 32 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 43472-43503 6 0.812
CP027355_7 7.13|4910479|32|CP027355|CRT 4910479-4910510 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755173-755204 7 0.781
CP027355_8 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT 4937154-4937185 32 MK455769 Aeromonas phage MJG, complete genome 10369-10400 7 0.781
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3331-3368 8 0.789
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3330-3367 8 0.789
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3330-3367 8 0.789
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3330-3367 8 0.789
CP027355_7 7.5|4910478|33|CP027355|PILER-CR,CRISPRCasFinder 4910478-4910510 33 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755204 8 0.758
CP027355_7 7.13|4910479|32|CP027355|CRT 4910479-4910510 32 NZ_CP007070 Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence 191920-191951 8 0.75
CP027355_7 7.16|4910662|32|CP027355|CRT 4910662-4910693 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP027355_8 8.3|4936422|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936422-4936453 32 NC_018454 Cronobacter phage phiES15, complete genome 8781-8812 8 0.75
CP027355_8 8.3|4936422|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936422-4936453 32 JQ780327 Cronobacter phage phiES15, complete sequence 8781-8812 8 0.75
CP027355_8 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4937032-4937063 32 NZ_CP013415 Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence 218852-218883 8 0.75
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14114-14151 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51843-51880 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229388-229425 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239882-239919 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230794-230831 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211764-211801 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40383-40420 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313601-313638 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386517-386554 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397090-397127 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404135-404172 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 114998-115035 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40307-40344 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 103-140 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31308-31345 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8897-8934 9 0.763
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17901-17938 9 0.763
CP027355_7 7.11|4910357|32|CP027355|CRT 4910357-4910388 32 NC_007959 Nitrobacter hamburgensis X14 plasmid 1, complete sequence 246573-246604 9 0.719
CP027355_8 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936544-4936575 32 NZ_CP009595 Bacillus cereus strain 3a plasmid pBFC_3, complete sequence 298003-298034 9 0.719
CP027355_8 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936544-4936575 32 NZ_CP009606 Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence 164238-164269 9 0.719
CP027355_8 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936544-4936575 32 NZ_CP053994 Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence 238009-238040 9 0.719
CP027355_8 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936544-4936575 32 NZ_CP053992 Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence 221025-221056 9 0.719
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 57083-57114 9 0.719
CP027355_8 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936727-4936758 32 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 238917-238948 9 0.719
CP027355_8 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936910-4936941 32 MN693584 Marine virus AFVG_25M163, complete genome 29591-29622 9 0.719
CP027355_8 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936910-4936941 32 MN103543 Pseudomonas phage vB_PaeM_PS119XW, complete genome 258501-258532 9 0.719
CP027355_8 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936910-4936941 32 MK599315 Pseudomonas phage PA1C, complete genome 257887-257918 9 0.719
CP027355_8 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4937032-4937063 32 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 208455-208486 9 0.719
CP027355_8 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT 4937154-4937185 32 NC_047954 Pseudomonas phage Njord, complete genome 11435-11466 9 0.719
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56040-56077 10 0.737
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58275-58312 10 0.737
CP027355_6 6.1|2912419|38|CP027355|CRISPRCasFinder 2912419-2912456 38 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30215-30252 10 0.737
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN694016 Marine virus AFVG_250M811, complete genome 5413-5444 10 0.688
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN694190 Marine virus AFVG_250M608, complete genome 5350-5381 10 0.688
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN693920 Marine virus AFVG_250M810, complete genome 5422-5453 10 0.688
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN693800 Marine virus AFVG_250M813, complete genome 5404-5435 10 0.688
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN694355 Marine virus AFVG_250M627, complete genome 26040-26071 10 0.688
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN694554 Marine virus AFVG_250M812, complete genome 5416-5447 10 0.688
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN694404 Marine virus AFVG_250M623, complete genome 5369-5400 10 0.688
CP027355_7 7.12|4910418|32|CP027355|CRT 4910418-4910449 32 MF158039 Shigella phage Sf12, complete genome 4975-5006 10 0.688
CP027355_7 7.12|4910418|32|CP027355|CRT 4910418-4910449 32 MF158042 Shigella phage Sd1, complete genome 938-969 10 0.688
CP027355_8 8.2|4936361|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936361-4936392 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 55281-55312 10 0.688
CP027355_8 8.4|4936483|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936483-4936514 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 50199-50230 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 19612-19643 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 115804-115835 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 116173-116204 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 182725-182756 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 110105-110136 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 109122-109153 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 221496-221527 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 207469-207500 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 199664-199695 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 13581-13612 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 73431-73462 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 187798-187829 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 106322-106353 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 148086-148117 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 93116-93147 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 185318-185349 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 219648-219679 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 158306-158337 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 93116-93147 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 167798-167829 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NC_002305 Salmonella typhi plasmid R27, complete sequence 128806-128837 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 91681-91712 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 183046-183077 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 37794-37825 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 36345-36376 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 124973-125004 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 184389-184420 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 94449-94480 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 26677-26708 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 182833-182864 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 183156-183187 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 183101-183132 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 197454-197485 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 205427-205458 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 191663-191694 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 49708-49739 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 126184-126215 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 93117-93148 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 181554-181585 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 182609-182640 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 182936-182967 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 182844-182875 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 182670-182701 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 183046-183077 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 182572-182603 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 180358-180389 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 176026-176057 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 130052-130083 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 182677-182708 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 182461-182492 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 41577-41608 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 203153-203184 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 109234-109265 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 20553-20584 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 58755-58786 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 179219-179250 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 194749-194780 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 146284-146315 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 176467-176498 10 0.688
CP027355_8 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936605-4936636 32 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 45801-45832 10 0.688
CP027355_8 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936727-4936758 32 LR134122 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2 259269-259300 10 0.688
CP027355_8 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4937032-4937063 32 NZ_CP041349 Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence 27173-27204 10 0.688
CP027355_8 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4937032-4937063 32 NZ_CP041350 Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence 149091-149122 10 0.688
CP027355_8 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4937032-4937063 32 NZ_CP004365 Komagataeibacter xylinus E25 plasmid pGX5, complete sequence 172655-172686 10 0.688
CP027355_8 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT 4937154-4937185 32 NC_047894 Pseudomonas phage uligo, complete genome 11353-11384 10 0.688
CP027355_7 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder 4910234-4910266 33 MN694016 Marine virus AFVG_250M811, complete genome 5413-5445 11 0.667
CP027355_7 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder 4910234-4910266 33 MN694190 Marine virus AFVG_250M608, complete genome 5350-5382 11 0.667
CP027355_7 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder 4910234-4910266 33 MN693920 Marine virus AFVG_250M810, complete genome 5422-5454 11 0.667
CP027355_7 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder 4910234-4910266 33 MN693800 Marine virus AFVG_250M813, complete genome 5404-5436 11 0.667
CP027355_7 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder 4910234-4910266 33 MN694554 Marine virus AFVG_250M812, complete genome 5416-5448 11 0.667
CP027355_7 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder 4910234-4910266 33 MN694404 Marine virus AFVG_250M623, complete genome 5369-5401 11 0.667
CP027355_7 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder 4910234-4910266 33 MN694355 Marine virus AFVG_250M627, complete genome 26039-26071 11 0.667
CP027355_7 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder 4910417-4910449 33 MF158039 Shigella phage Sf12, complete genome 4974-5006 11 0.667
CP027355_7 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder 4910417-4910449 33 MF158042 Shigella phage Sd1, complete genome 937-969 11 0.667
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN694191 Marine virus AFVG_250M444, complete genome 10652-10683 11 0.656
CP027355_7 7.9|4910235|32|CP027355|CRT 4910235-4910266 32 MN694065 Marine virus AFVG_250M443, complete genome 44541-44572 11 0.656
CP027355_8 8.7|4936666|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936666-4936697 32 MT344105 Acinetobacter phage fLi-Aba03, complete genome 32699-32730 11 0.656
CP027355_8 8.7|4936666|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936666-4936697 32 MT344104 Acinetobacter phage fLi-Aba02, complete genome 32861-32892 11 0.656
CP027355_8 8.7|4936666|32|CP027355|PILER-CR,CRISPRCasFinder,CRT 4936666-4936697 32 MT344103 Acinetobacter phage fEg-Aba01, complete genome 31614-31645 11 0.656

1. spacer 3.1|1775388|40|CP027355|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042584 (Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence) position: , mismatch: 0, identity: 1.0 

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggggaaaacgaacaatctgttt	Protospacer
********************************

3. spacer 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 1, identity: 0.969 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
***********************.********

4. spacer 2.1|852737|38|CP027355|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 7.12|4910418|32|CP027355|CRT matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

6. spacer 7.12|4910418|32|CP027355|CRT matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 3, identity: 0.906 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

7. spacer 7.12|4910418|32|CP027355|CRT matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 3, identity: 0.906 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
gggttcgcggcgttaacgctcaccagcatttc	Protospacer
* ***.*****.********************

8. spacer 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder matches to NZ_LR134258 (Klebsiella aerogenes strain NCTC9644 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.879 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

9. spacer 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder matches to LR134281 (Klebsiella aerogenes strain NCTC9793 genome assembly, plasmid: 6) position: , mismatch: 4, identity: 0.879 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

10. spacer 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder matches to KY271401 (Klebsiella phage 1 LV-2017, complete genome) position: , mismatch: 4, identity: 0.879 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggggttcgcggcgttaacgctcaccagcatttc	Protospacer
 * ***.*****.********************

11. spacer 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MF547662 (Clostridioides phage LIBA6276, complete genome) position: , mismatch: 4, identity: 0.875 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** *

12. spacer 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MF547663 (Clostridioides phage LIBA2945, complete genome) position: , mismatch: 4, identity: 0.875 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cttataaaa	Protospacer
*** ******************* .***** *

13. spacer 7.12|4910418|32|CP027355|CRT matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 5, identity: 0.844 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ggttgtgcggcgttaacgctgaccagcatttc	Protospacer
*  * ******.******** ***********

14. spacer 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_014108 (Enterobacter cloacae subsp. cloacae ATCC 13047 plasmid pECL_B, complete sequence) position: , mismatch: 5, identity: 0.844 

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

15. spacer 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030922 (Escherichia coli strain KL53 plasmid pKL53-S, complete sequence) position: , mismatch: 5, identity: 0.844 

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

16. spacer 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038659 (Citrobacter freundii strain 680 plasmid p680_1, complete sequence) position: , mismatch: 5, identity: 0.844 

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

17. spacer 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MN699848 (Citrobacter pasteurii strain 175G8 plasmid pCfr-OXA-198, complete sequence) position: , mismatch: 5, identity: 0.844 

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tcatgaatatggcgaaaatgaacaatcagcct	Protospacer
************ *****.******** *..*

18. spacer 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844 

tacagtttccataaattcacctcgtttatata-	CRISPR spacer
tactgtttccataaattcacctc-cctataaaa	Protospacer
*** ******************* ..**** *

19. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

20. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

21. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

22. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

23. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

24. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

25. spacer 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder matches to KY653119 (Morganella phage IME1369_02, complete genome) position: , mismatch: 6, identity: 0.818 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
aggttgtgcggcgttaacgctgaccagcatttc	Protospacer
 *  * ******.******** ***********

26. spacer 8.4|4936483|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 6, identity: 0.812 

ggcgagtccgtcagcggtgcgccgctg-caaca	CRISPR spacer
gtcgagtaagtcagcggtgcgccgcgatcaac-	Protospacer
* *****  **************** . ****

27. spacer 7.13|4910479|32|CP027355|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
ccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
 *******.**************** *.. *.

28. spacer 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT matches to MK455769 (Aeromonas phage MJG, complete genome) position: , mismatch: 7, identity: 0.781 

gacgcactggatgcgatgatggatatcacttg-	CRISPR spacer
gacgcactgtatgcaatgatgga-atcggaggc	Protospacer
********* ****.******** ***.   *

29. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

30. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

31. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

32. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

33. spacer 7.5|4910478|33|CP027355|PILER-CR,CRISPRCasFinder matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.758 

gacgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
tccgtggtcgtgggtgctgctgttgctggagcg	Protospacer
  *******.**************** *.. *.

34. spacer 7.13|4910479|32|CP027355|CRT matches to NZ_CP007070 (Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

acgtggtcatgggtgctgctgttgcagagcca	CRISPR spacer
atgcggtcatggatgctgatgttgcagtgatg	Protospacer
*.*.********.***** ******** * ..

35. spacer 7.16|4910662|32|CP027355|CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

36. spacer 8.3|4936422|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_018454 (Cronobacter phage phiES15, complete genome) position: , mismatch: 8, identity: 0.75 

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

37. spacer 8.3|4936422|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to JQ780327 (Cronobacter phage phiES15, complete sequence) position: , mismatch: 8, identity: 0.75 

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

38. spacer 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013415 (Burkholderia ubonensis strain MSMB2035 plasmid pMSMB2035, complete sequence) position: , mismatch: 8, identity: 0.75 

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
aatctacaggccgtgacggttgtcatggaggc	Protospacer
     *****************.*** *** *

39. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta	Protospacer
*...**.**********.**************..**..

40. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta	Protospacer
. * **.**********.**************..**..

41. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

42. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

43. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

44. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

45. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

46. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
 *. **.**********.**************..**..

47. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

48. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*..**.**********.**************..**..

49. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

50. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
. .***.**********.**************. **..

51. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta	Protospacer
*   **.**********.**************..**..

52. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta	Protospacer
  *.**.**********.**************..**..

53. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

54. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta	Protospacer
..*.**.**********.**************..**..

55. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac	Protospacer
 * .**.**********.**************..**

56. spacer 7.11|4910357|32|CP027355|CRT matches to NC_007959 (Nitrobacter hamburgensis X14 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcaaaaaccgggcaatcgcaaaaaggcgtaat	CRISPR spacer
gaaaaaaccgcccaatcgcaaaaagatgacga	Protospacer
* ********  *************..*  .

57. spacer 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009595 (Bacillus cereus strain 3a plasmid pBFC_3, complete sequence) position: , mismatch: 9, identity: 0.719 

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  **************

58. spacer 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009606 (Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  **************

59. spacer 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053994 (Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  **************

60. spacer 8.5|4936544|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053992 (Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

ggacaatgtgaaaagcttaatattcattacat	CRISPR spacer
aaggaaaatgaaaagaataatattcattacag	Protospacer
... ** .*******  **************

61. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatatcacccagcactccggg	Protospacer
  *  ******************** ** .

62. spacer 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
tctgctgcatgggggaaacgatcaatctgttg	Protospacer
**    ..******.****** *********

63. spacer 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MN693584 (Marine virus AFVG_25M163, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
ggggatatctataaactcacctcgtttatatt	Protospacer
 . ..* **.*****.***************

64. spacer 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MN103543 (Pseudomonas phage vB_PaeM_PS119XW, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

65. spacer 8.11|4936910|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MK599315 (Pseudomonas phage PA1C, complete genome) position: , mismatch: 9, identity: 0.719 

tacagtttccataaattcacctcgtttatata	CRISPR spacer
cgcttcttccatacattcacctcggttatgga	Protospacer
..*  .******* ********** ****. *

66. spacer 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 9, identity: 0.719 

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gctgcacagggtgtgacggttgccattgccga	Protospacer
 * * ***** .****************

67. spacer 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 9, identity: 0.719 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggccgaggc	Protospacer
******** ************** ..*.

68. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta	Protospacer
. ..**.**********.**************..**..

69. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata	Protospacer
 .*.**.**********.**************..* ..

70. spacer 6.1|2912419|38|CP027355|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta	Protospacer
.*. **.**********.*************...**..

71. spacer 7.9|4910235|32|CP027355|CRT matches to MN694016 (Marine virus AFVG_250M811, complete genome) position: , mismatch: 10, identity: 0.688 

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.

72. spacer 7.9|4910235|32|CP027355|CRT matches to MN694190 (Marine virus AFVG_250M608, complete genome) position: , mismatch: 10, identity: 0.688 

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatacct	Protospacer
.  .*********.***********.**.

73. spacer 7.9|4910235|32|CP027355|CRT matches to MN693920 (Marine virus AFVG_250M810, complete genome) position: , mismatch: 10, identity: 0.688 

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.

74. spacer 7.9|4910235|32|CP027355|CRT matches to MN693800 (Marine virus AFVG_250M813, complete genome) position: , mismatch: 10, identity: 0.688 

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.

75. spacer 7.9|4910235|32|CP027355|CRT matches to MN694355 (Marine virus AFVG_250M627, complete genome) position: , mismatch: 10, identity: 0.688 

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.

76. spacer 7.9|4910235|32|CP027355|CRT matches to MN694554 (Marine virus AFVG_250M812, complete genome) position: , mismatch: 10, identity: 0.688 

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatactt	Protospacer
.  .*********.***********.**.

77. spacer 7.9|4910235|32|CP027355|CRT matches to MN694404 (Marine virus AFVG_250M623, complete genome) position: , mismatch: 10, identity: 0.688 

cggcccataatattaatataatccacatgagg	CRISPR spacer
tcttccataatatcaatataatccatatacct	Protospacer
.  .*********.***********.**.

78. spacer 7.12|4910418|32|CP027355|CRT matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 10, identity: 0.688 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctccccaagtgccg	Protospacer
 *******.************ ***.   ..

79. spacer 7.12|4910418|32|CP027355|CRT matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 10, identity: 0.688 

gtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
ttgtttgcagcattaacgctctccaagtgccg	Protospacer
 *******.************ ***.   ..

80. spacer 8.2|4936361|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggcacggaattgttatgctgttcccctgaccg	CRISPR spacer
tcttcggaattgccatgctgttccccttccat	Protospacer
  . ********..*************  *

81. spacer 8.4|4936483|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggcgagtccgtcagcggtgcgccgctgcaaca	CRISPR spacer
ttggagtccgacatcggtgcgccgcttttcga	Protospacer
   ******* ** ************ .   *

82. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

83. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

84. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

85. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

86. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

87. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

88. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

89. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

90. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

91. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

92. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

93. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

94. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

95. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

96. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

97. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

98. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

99. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

100. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

101. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

102. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

103. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

104. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

105. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

106. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

107. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

108. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

109. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

110. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

111. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

112. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

113. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

114. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

115. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

116. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

117. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

118. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

119. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

120. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

121. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

122. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

123. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

124. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

125. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

126. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

127. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

128. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

129. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

130. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

131. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

132. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

133. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

134. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

135. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

136. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

137. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

138. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

139. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

140. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

141. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

142. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

143. spacer 8.6|4936605|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 10, identity: 0.688 

cgacgttttctaatatcacccagcaatcaatt	CRISPR spacer
gtaacttttctaatctcacccagcactccggg	Protospacer
  *  ********* ********** ** .

144. spacer 8.8|4936727|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 10, identity: 0.688 

tcatgaatatggggaaaacgaacaatctgttt	CRISPR spacer
agctgaatatggggaaaatgcacaatatcccc	Protospacer
   ***************.* ***** * ...

145. spacer 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041349 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pA, complete sequence) position: , mismatch: 10, identity: 0.688 

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gacggacaggccgccacggttgccatcaggaa	Protospacer
   **********. ***********...*

146. spacer 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041350 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pB, complete sequence) position: , mismatch: 10, identity: 0.688 

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gatggacaggctgtgacggtcgccatcaggaa	Protospacer
   ********.********.*****...*

147. spacer 8.13|4937032|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004365 (Komagataeibacter xylinus E25 plasmid pGX5, complete sequence) position: , mismatch: 10, identity: 0.688 

ccaggacaggccgtgacggttgccattgagtc	CRISPR spacer
gatggacaggctgtgacggtcgccatcaggaa	Protospacer
   ********.********.*****...*

148. spacer 8.15|4937154|32|CP027355|CRISPRCasFinder,CRT matches to NC_047894 (Pseudomonas phage uligo, complete genome) position: , mismatch: 10, identity: 0.688 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggcagaagc	Protospacer
******** ************** .. .

149. spacer 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder matches to MN694016 (Marine virus AFVG_250M811, complete genome) position: , mismatch: 11, identity: 0.667 

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.

150. spacer 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder matches to MN694190 (Marine virus AFVG_250M608, complete genome) position: , mismatch: 11, identity: 0.667 

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatacct	Protospacer
 .  .*********.***********.**.

151. spacer 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder matches to MN693920 (Marine virus AFVG_250M810, complete genome) position: , mismatch: 11, identity: 0.667 

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.

152. spacer 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder matches to MN693800 (Marine virus AFVG_250M813, complete genome) position: , mismatch: 11, identity: 0.667 

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.

153. spacer 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder matches to MN694554 (Marine virus AFVG_250M812, complete genome) position: , mismatch: 11, identity: 0.667 

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.

154. spacer 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder matches to MN694404 (Marine virus AFVG_250M623, complete genome) position: , mismatch: 11, identity: 0.667 

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatacct	Protospacer
 .  .*********.***********.**.

155. spacer 7.1|4910234|33|CP027355|PILER-CR,CRISPRCasFinder matches to MN694355 (Marine virus AFVG_250M627, complete genome) position: , mismatch: 11, identity: 0.667 

gcggcccataatattaatataatccacatgagg	CRISPR spacer
ttcttccataatatcaatataatccatatactt	Protospacer
 .  .*********.***********.**.

156. spacer 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder matches to MF158039 (Shigella phage Sf12, complete genome) position: , mismatch: 11, identity: 0.667 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctccccaagtgccg	Protospacer
  *******.************ ***.   ..

157. spacer 7.4|4910417|33|CP027355|PILER-CR,CRISPRCasFinder matches to MF158042 (Shigella phage Sd1, complete genome) position: , mismatch: 11, identity: 0.667 

tgtgtttgcggcattaacgctcaccagcatttc	CRISPR spacer
attgtttgcagcattaacgctctccaagtgccg	Protospacer
  *******.************ ***.   ..

158. spacer 7.9|4910235|32|CP027355|CRT matches to MN694191 (Marine virus AFVG_250M444, complete genome) position: , mismatch: 11, identity: 0.656 

cggcccataatattaatataatccacatgagg	CRISPR spacer
gttaatgtaatattattataatcaacatgacc	Protospacer
     ..******** ******* ******

159. spacer 7.9|4910235|32|CP027355|CRT matches to MN694065 (Marine virus AFVG_250M443, complete genome) position: , mismatch: 11, identity: 0.656 

cggcccataatattaatataatccacatgagg	CRISPR spacer
gttaatgtaatattattataatcaacatgacc	Protospacer
     ..******** ******* ******

160. spacer 8.7|4936666|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MT344105 (Acinetobacter phage fLi-Aba03, complete genome) position: , mismatch: 11, identity: 0.656 

atttcatcaaagcattaagggatggaataaag	CRISPR spacer
ctttcatcaaagtattaatggatgatggttca	Protospacer
 ***********.***** *****. .    .

161. spacer 8.7|4936666|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MT344104 (Acinetobacter phage fLi-Aba02, complete genome) position: , mismatch: 11, identity: 0.656 

atttcatcaaagcattaagggatggaataaag	CRISPR spacer
ctttcatcaaagtattaatggatgatggttca	Protospacer
 ***********.***** *****. .    .

162. spacer 8.7|4936666|32|CP027355|PILER-CR,CRISPRCasFinder,CRT matches to MT344103 (Acinetobacter phage fEg-Aba01, complete genome) position: , mismatch: 11, identity: 0.656 

atttcatcaaagcattaagggatggaataaag	CRISPR spacer
ctttcatcaaagtattaatggatgatggttca	Protospacer
 ***********.***** *****. .    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage