Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027460 Escherichia coli strain 90-3040 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP027459 Escherichia coli strain 90-3040 chromosome, complete genome 10 crisprs NA 0 6 0 0

Results visualization

1. CP027459
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_1 789187-789323 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_2 1300089-1300212 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_3 2109530-2109621 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_4 2372653-2372801 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_5 3250784-3250899 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_6 3273812-3273944 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_7 3454431-3454543 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_8 4766757-4766877 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_9 5186166-5186249 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027459_10 5212663-5212753 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027459_6 6.1|3273829|42|CP027459|PILER-CR 3273829-3273870 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027459_3 3.1|2109556|40|CP027459|CRISPRCasFinder 2109556-2109595 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP027459_5 5.1|3250815|54|CP027459|CRISPRCasFinder 3250815-3250868 54 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 165411-165464 1 0.981
CP027459_6 6.2|3273888|40|CP027459|PILER-CR 3273888-3273927 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 1 0.975
CP027459_2 2.1|1300132|38|CP027459|CRISPRCasFinder 1300132-1300169 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027459_7 7.1|3454459|57|CP027459|CRISPRCasFinder 3454459-3454515 57 NZ_CP044307 Escherichia coli strain C27A plasmid pC27A-2, complete sequence 15004-15060 11 0.807
CP027459_5 5.1|3250815|54|CP027459|CRISPRCasFinder 3250815-3250868 54 NZ_CP048385 Citrobacter freundii strain 62 plasmid p6_C, complete sequence 72431-72484 12 0.778
CP027459_7 7.1|3454459|57|CP027459|CRISPRCasFinder 3454459-3454515 57 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12104-12160 13 0.772
CP027459_7 7.1|3454459|57|CP027459|CRISPRCasFinder 3454459-3454515 57 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3364-3420 15 0.737
CP027459_7 7.1|3454459|57|CP027459|CRISPRCasFinder 3454459-3454515 57 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3363-3419 15 0.737
CP027459_7 7.1|3454459|57|CP027459|CRISPRCasFinder 3454459-3454515 57 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3363-3419 15 0.737
CP027459_7 7.1|3454459|57|CP027459|CRISPRCasFinder 3454459-3454515 57 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3363-3419 15 0.737

1. spacer 6.1|3273829|42|CP027459|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

tgtcacacgcagataaatccaactttcaatattgttaagttc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
******************************************

2. spacer 3.1|2109556|40|CP027459|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

gcgctgcgggtcattcttgaaattccccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
************************ ***************

3. spacer 5.1|3250815|54|CP027459|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.981 

tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
tggcctacacgctgcgattttgtaggccggataagcaaagcgcatccggcattg	Protospacer
*****************************************************

4. spacer 6.2|3273888|40|CP027459|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975 

catggcgtagcaaaaagaaattttcaatattgctttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *****************************

5. spacer 2.1|1300132|38|CP027459|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

6. spacer 7.1|3454459|57|CP027459|CRISPRCasFinder matches to NZ_CP044307 (Escherichia coli strain C27A plasmid pC27A-2, complete sequence) position: , mismatch: 11, identity: 0.807 

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggcaatgctgttattgt-	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggc-acctggtaattgtt	Protospacer
.*..********* ************* *************** *. . ** *****

7. spacer 5.1|3250815|54|CP027459|CRISPRCasFinder matches to NZ_CP048385 (Citrobacter freundii strain 62 plasmid p6_C, complete sequence) position: , mismatch: 12, identity: 0.778 

tggcctacacgct-----gcgattttgtaggccggataagcaaagcgcatccggcattc	CRISPR spacer
-----tacaaattaattcgcggtattgtaggccggataagcaaagcgcatccggcagta	Protospacer
     **** ..*     ***.* ******************************** *

8. spacer 7.1|3454459|57|CP027459|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.772 

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggcaatgctgttattgt---	CRISPR spacer
gcgactcgtaggcctgataagacgcgccagcgtcgcatcaggcaccg-----aacgtcgg	Protospacer
  .************************ **************** .*     * .**

9. spacer 7.1|3454459|57|CP027459|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 15, identity: 0.737 

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*

10. spacer 7.1|3454459|57|CP027459|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 15, identity: 0.737 

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*

11. spacer 7.1|3454459|57|CP027459|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 15, identity: 0.737 

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*

12. spacer 7.1|3454459|57|CP027459|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 15, identity: 0.737 

tgaactcgtaggcctgataagacgcgcgagcgtcgcatcaggca-----atgctgttatt	CRISPR spacer
cgggctcgtaggcatgataagacgcgccagcgtcgcatcaggcacctgcgtacaact---	Protospacer
.*..********* ************* ****************     .*.* ..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage