Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027545 Escherichia coli strain 2013C-3264 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP027544 Escherichia coli strain 2013C-3264 chromosome, complete genome 5 crisprs NA 0 16 0 0

Results visualization

1. CP027544
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027544_1 131990-132113 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027544_2 881090-881181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027544_3 1778701-1779523 Orphan I-E
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027544_4 1805223-1805556 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027544_5 4852854-4853002 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027544_2 2.1|881116|40|CP027544|CRISPRCasFinder 881116-881155 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027544_1 1.1|132033|38|CP027544|CRISPRCasFinder 132033-132070 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027544_3 3.8|1779158|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779158-1779189 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246449-246480 2 0.938
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP053858 Rhizobium pusense strain 76 plasmid pR76, complete sequence 455664-455695 5 0.844
CP027544_3 3.3|1778852|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1778852-1778883 32 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 649166-649197 6 0.812
CP027544_4 4.1|1805252|32|CP027544|CRISPRCasFinder,CRT 1805252-1805283 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 6 0.812
CP027544_4 4.2|1805313|32|CP027544|CRISPRCasFinder,CRT 1805313-1805344 32 MH389777 Dickeya phage vB_DsoM_JA11, complete genome 116689-116720 6 0.812
CP027544_4 4.2|1805313|32|CP027544|CRISPRCasFinder,CRT 1805313-1805344 32 MH460462 Dickeya phage vB_DsoM_JA33, complete genome 116679-116710 6 0.812
CP027544_4 4.6|1805253|32|CP027544|PILER-CR 1805253-1805284 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 6 0.812
CP027544_4 4.7|1805314|32|CP027544|PILER-CR 1805314-1805345 32 MH389777 Dickeya phage vB_DsoM_JA11, complete genome 116689-116720 6 0.812
CP027544_4 4.7|1805314|32|CP027544|PILER-CR 1805314-1805345 32 MH460462 Dickeya phage vB_DsoM_JA33, complete genome 116679-116710 6 0.812
CP027544_3 3.3|1778852|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1778852-1778883 32 MT889371 Microbacterium phage DelaGarza, complete genome 35549-35580 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 270741-270772 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 1429126-1429157 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 450512-450543 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 1363718-1363749 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 259589-259620 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 156145-156176 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021819 Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence 108131-108162 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 136871-136902 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 308731-308762 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NC_018683 Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence 386165-386196 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 1141409-1141440 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021809 Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence 239251-239282 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 1491172-1491203 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 173783-173814 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 251909-251940 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 227862-227893 8 0.75
CP027544_3 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779341-1779372 32 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 270403-270434 8 0.75
CP027544_3 3.2|1778791|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1778791-1778822 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 9 0.719
CP027544_3 3.3|1778852|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1778852-1778883 32 NZ_CP044425 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence 203634-203665 9 0.719
CP027544_3 3.10|1779280|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779280-1779311 32 MT708550 Achromobacter phage Mano, complete genome 2686-2717 9 0.719
CP027544_4 4.2|1805313|32|CP027544|CRISPRCasFinder,CRT 1805313-1805344 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 712830-712861 9 0.719
CP027544_4 4.7|1805314|32|CP027544|PILER-CR 1805314-1805345 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 712830-712861 9 0.719
CP027544_3 3.7|1779097|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779097-1779128 32 NZ_CP013917 Sphingomonas sp. LK11 plasmid unnamed2, complete sequence 27233-27264 10 0.688
CP027544_4 4.4|1805435|32|CP027544|CRISPRCasFinder,CRT 1805435-1805466 32 MN694030 Marine virus AFVG_250M187, complete genome 18204-18235 10 0.688
CP027544_4 4.9|1805436|32|CP027544|PILER-CR 1805436-1805467 32 MN694030 Marine virus AFVG_250M187, complete genome 18204-18235 10 0.688
CP027544_3 3.9|1779219|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779219-1779250 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1789771-1789802 11 0.656
CP027544_3 3.9|1779219|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779219-1779250 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 23490-23521 11 0.656
CP027544_3 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779402-1779433 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 11 0.656
CP027544_3 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779402-1779433 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 11 0.656
CP027544_3 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779402-1779433 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 11 0.656
CP027544_3 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT 1779402-1779433 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 11 0.656

1. spacer 2.1|881116|40|CP027544|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 1.1|132033|38|CP027544|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 3.8|1779158|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 2, identity: 0.938 

cttaccacccagacactgatactccacataaa	CRISPR spacer
ctttccacccaggcactgatactccacataaa	Protospacer
*** ********.*******************

4. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 5, identity: 0.844 

atgtcgagcgcgttgacagctatatt-cgccgt	CRISPR spacer
ttgacgagcgcgtcgacagctatattgcgcca-	Protospacer
 ** *********.************ ****.

5. spacer 3.3|1778852|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 6, identity: 0.812 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgggcgtaccgcatcgcggacaacaagctga	Protospacer
.** ******** **************..**

6. spacer 4.1|1805252|32|CP027544|CRISPRCasFinder,CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

gtgaccgtcggtgttacgctgaactgctgaaa--	CRISPR spacer
gtgaccgtcggtgttccggtgaa--gcggaaggc	Protospacer
*************** ** ****  ** ***.

7. spacer 4.2|1805313|32|CP027544|CRISPRCasFinder,CRT matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 6, identity: 0.812 

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

8. spacer 4.2|1805313|32|CP027544|CRISPRCasFinder,CRT matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 6, identity: 0.812 

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

9. spacer 4.6|1805253|32|CP027544|PILER-CR matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

gtgaccgtcggtgttacgctgaactgctgaaa--	CRISPR spacer
gtgaccgtcggtgttccggtgaa--gcggaaggc	Protospacer
*************** ** ****  ** ***.

10. spacer 4.7|1805314|32|CP027544|PILER-CR matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 6, identity: 0.812 

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

11. spacer 4.7|1805314|32|CP027544|PILER-CR matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 6, identity: 0.812 

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
tttacctgcaacacctgcaagcacatcaacgc	Protospacer
  **..*********.***** **********

12. spacer 3.3|1778852|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to MT889371 (Microbacterium phage DelaGarza, complete genome) position: , mismatch: 8, identity: 0.75 

acgcgcgtaccggatcgcggacaacaaattgc	CRISPR spacer
gcgcgcctaccggatcgcggacaaccgcacgg	Protospacer
.***** ****************** .  .*

13. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

14. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

15. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

16. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

17. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

18. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

19. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

20. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

21. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

22. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

23. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

24. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

25. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

26. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

27. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

28. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

29. spacer 3.11|1779341|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75 

atgtcgagcgcgttgacagctatattcgccgt	CRISPR spacer
ggtttgagcgcattaacagctatattcggcat	Protospacer
.  *.******.**.************* *.*

30. spacer 3.2|1778791|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

gtgaccgtcggtgttacgctgaactgctggaa	CRISPR spacer
gtgaccgtcggtgttccggtgaagcggaaggc	Protospacer
*************** ** **** .*  .*.

31. spacer 3.3|1778852|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.719 

acgcgcgtaccggatcgcggacaacaaattgc------	CRISPR spacer
tcgcgcggaccggatcgcggccaa------gccccgcg	Protospacer
 ****** ************ ***      **

32. spacer 3.10|1779280|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to MT708550 (Achromobacter phage Mano, complete genome) position: , mismatch: 9, identity: 0.719 

gcaaattaccgccgggctaacgtttgatctca	CRISPR spacer
tagcattaccgccgggcttacctttgaccgcc	Protospacer
  . ************** ** *****.* *

33. spacer 4.2|1805313|32|CP027544|CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
agccagttcagcaccagcaagaacatcaacga	Protospacer
*..   * **.**** ***************

34. spacer 4.7|1805314|32|CP027544|PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

aatatttgcaacacccgcaagaacatcaacgc	CRISPR spacer
agccagttcagcaccagcaagaacatcaacga	Protospacer
*..   * **.**** ***************

35. spacer 3.7|1779097|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013917 (Sphingomonas sp. LK11 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688 

tgttttcccaacggtttgattgacttaaaccg	CRISPR spacer
atcaaatcaaacggttggattgatttaaaccg	Protospacer
  .   .* ******* ******.********

36. spacer 4.4|1805435|32|CP027544|CRISPRCasFinder,CRT matches to MN694030 (Marine virus AFVG_250M187, complete genome) position: , mismatch: 10, identity: 0.688 

tttacatcatccgcagctatataaaaattagg	CRISPR spacer
gacgcaccatccgcagctatagaaaaatatta	Protospacer
  ..**.************** ******   .

37. spacer 4.9|1805436|32|CP027544|PILER-CR matches to MN694030 (Marine virus AFVG_250M187, complete genome) position: , mismatch: 10, identity: 0.688 

tttacatcatccgcagctatataaaaattagg	CRISPR spacer
gacgcaccatccgcagctatagaaaaatatta	Protospacer
  ..**.************** ******   .

38. spacer 3.9|1779219|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 11, identity: 0.656 

tcacgcggagtgagacggcgtacgagcattgc	CRISPR spacer
aggagcggagtgtgaaggcgtacgagcccact	Protospacer
  . ******** ** *********** .  .

39. spacer 3.9|1779219|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 11, identity: 0.656 

tcacgcggagtgagacggcgtacgagcattgc	CRISPR spacer
aggagcggagtgtgaaggcgtacgagcccact	Protospacer
  . ******** ** *********** .  .

40. spacer 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 11, identity: 0.656 

ggtcgctggtcaaattcccaatctgagcagtc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 ..  ** * ******************....

41. spacer 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 11, identity: 0.656 

ggtcgctggtcaaattcccaatctgagcagtc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 ..  ** * ******************....

42. spacer 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 11, identity: 0.656 

ggtcgctggtcaaattcccaatctgagcagtc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 ..  ** * ******************....

43. spacer 3.12|1779402|32|CP027544|PILER-CR,CRISPRCasFinder,CRT matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 11, identity: 0.656 

ggtcgctggtcaaattcccaatctgagcagtc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 ..  ** * ******************....

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage