1. spacer 3.2|3990609|32|CP027640|CRISPRCasFinder,CRT matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 1, identity: 0.969
tccgtccaccctgatagccgcccttgtgatcc CRISPR spacer
tccgtcctccctgatagccgcccttgtgatcc Protospacer
******* ************************
2. spacer 3.13|3990610|32|CP027640|PILER-CR matches to MT330372 (Cronobacter phage JC01, complete genome) position: , mismatch: 1, identity: 0.969
tccgtccaccctgatagccgcccttgtgatcc CRISPR spacer
tccgtcctccctgatagccgcccttgtgatcc Protospacer
******* ************************
3. spacer 2.2|3964639|32|CP027640|PILER-CR,CRISPRCasFinder,CRT matches to MK356558 (Salmonella sp. strain Sa1423 plasmid pSa1423-160k, complete sequence) position: , mismatch: 4, identity: 0.875
gcagactataacgagggtcgcacgcggatcat-- CRISPR spacer
gccgactataacgaaggtcgcacgc--atcataa Protospacer
** ***********.********** *****
4. spacer 2.2|3964639|32|CP027640|PILER-CR,CRISPRCasFinder,CRT matches to MK356557 (Salmonella sp. strain Sa1423 plasmid pSa1423-90k, complete sequence) position: , mismatch: 5, identity: 0.844
gcagactataacgagggtcgcacgcggatcat- CRISPR spacer
gccgactataacgaaggtcgcacgcata-cata Protospacer
** ***********.**********. * ***
5. spacer 3.7|3990914|32|CP027640|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggcgttaacgcggtgatactgtttgacgg CRISPR spacer
ttgatcgttaacgcgatgctactgtttgtggg Protospacer
.*. **********.** ********* **
6. spacer 3.18|3990915|32|CP027640|PILER-CR matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 8, identity: 0.75
gcgggcgttaacgcggtgatactgtttgacgg CRISPR spacer
ttgatcgttaacgcgatgctactgtttgtggg Protospacer
.*. **********.** ********* **
7. spacer 2.1|3964578|32|CP027640|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tcacgcgctgttacccagtccctttttttcag CRISPR spacer
tcttataatgttatccagtacctttttttcat Protospacer
** .... *****.***** ***********
8. spacer 2.3|3964700|32|CP027640|PILER-CR,CRISPRCasFinder,CRT matches to AP018320 (Nostoc sp. HK-01 plasmid plasmid2 DNA, complete genome) position: , mismatch: 9, identity: 0.719
---taccaaaccggaatctttccatataacggcgg CRISPR spacer
ggattttga---ggaagctttctatataacggcgg Protospacer
* ...* **** *****.************
9. spacer 3.4|3990731|32|CP027640|CRISPRCasFinder,CRT matches to MK075004 (Staphylococcus phage phiSP119-1, complete genome) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gcttacttttttcgacatcaggaaaaaatatc Protospacer
*... ***********.********* **
10. spacer 3.4|3990731|32|CP027640|CRISPRCasFinder,CRT matches to MK075002 (Staphylococcus phage phiSP38-1, complete genome) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gcttacttttttcgacatcaggaaaaaatatc Protospacer
*... ***********.********* **
11. spacer 3.4|3990731|32|CP027640|CRISPRCasFinder,CRT matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gtcctcttttttcgagatcaggatatctctcg Protospacer
*************** .****** * . .. *
12. spacer 3.4|3990731|32|CP027640|CRISPRCasFinder,CRT matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gtcctcttttttcgagatcaggatatctctcg Protospacer
*************** .****** * . .. *
13. spacer 3.11|3991158|32|CP027640|CRISPRCasFinder,CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 9, identity: 0.719
gactcaaaacggcgcaggtcaaaatcgttcaa CRISPR spacer
agcgaagcacggcgcgcgtcaaaatcgttcat Protospacer
..* *. *******. **************
14. spacer 3.11|3991158|32|CP027640|CRISPRCasFinder,CRT matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 9, identity: 0.719
gactcaaaacggcgcaggtcaaaatcgttcaa CRISPR spacer
aactcaagacggcgcagttcaaaaacaaggag Protospacer
.******.********* ****** *. *.
15. spacer 3.15|3990732|32|CP027640|PILER-CR matches to MK075004 (Staphylococcus phage phiSP119-1, complete genome) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gcttacttttttcgacatcaggaaaaaatatc Protospacer
*... ***********.********* **
16. spacer 3.15|3990732|32|CP027640|PILER-CR matches to MK075002 (Staphylococcus phage phiSP38-1, complete genome) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gcttacttttttcgacatcaggaaaaaatatc Protospacer
*... ***********.********* **
17. spacer 3.15|3990732|32|CP027640|PILER-CR matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gtcctcttttttcgagatcaggatatctctcg Protospacer
*************** .****** * . .. *
18. spacer 3.15|3990732|32|CP027640|PILER-CR matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 9, identity: 0.719
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
gtcctcttttttcgagatcaggatatctctcg Protospacer
*************** .****** * . .. *
19. spacer 3.22|3991159|32|CP027640|PILER-CR matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 9, identity: 0.719
gactcaaaacggcgcaggtcaaaatcgttcaa CRISPR spacer
agcgaagcacggcgcgcgtcaaaatcgttcat Protospacer
..* *. *******. **************
20. spacer 3.22|3991159|32|CP027640|PILER-CR matches to NZ_AP022566 (Mycolicibacterium alvei strain JCM 12272 plasmid pJCM12272, complete sequence) position: , mismatch: 9, identity: 0.719
gactcaaaacggcgcaggtcaaaatcgttcaa CRISPR spacer
aactcaagacggcgcagttcaaaaacaaggag Protospacer
.******.********* ****** *. *.
21. spacer 3.4|3990731|32|CP027640|CRISPRCasFinder,CRT matches to NZ_CP017591 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence) position: , mismatch: 10, identity: 0.688
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
caatttcatttttgatgtcaggaaaatatcgc Protospacer
.*.. ****.**.***************
22. spacer 3.15|3990732|32|CP027640|PILER-CR matches to NZ_CP017591 (Pantoea stewartii subsp. stewartii DC283 plasmid pDSJ10, complete sequence) position: , mismatch: 10, identity: 0.688
gtcctcttttttcgacgtcaggaaaatatcgg CRISPR spacer
caatttcatttttgatgtcaggaaaatatcgc Protospacer
.*.. ****.**.***************