Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027767 Escherichia coli strain 2013C-3342 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP027766 Escherichia coli strain 2013C-3342 chromosome, complete genome 7 crisprs NA 0 8 0 0

Results visualization

1. CP027766
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027766_1 871686-871809 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027766_2 1570422-1570513 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027766_3 2072127-2072260 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027766_4 2108302-2108383 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027766_5 4783314-4783431 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027766_6 5222897-5223230 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027766_7 5248339-5248733 Orphan I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027766_2 2.1|1570448|40|CP027766|CRISPRCasFinder 1570448-1570487 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 NC_004813 Enterobacteria phage BP-4795, complete genome 54801-54832 0 1.0
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 AJ556162 Phage BP-4795 complete genome 54801-54832 0 1.0
CP027766_1 1.1|871729|38|CP027766|CRISPRCasFinder 871729-871766 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP027766_3 3.1|2072165|58|CP027766|CRISPRCasFinder 2072165-2072222 58 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 104-161 5 0.914
CP027766_7 7.6|5248673|32|CP027766|PILER-CR,CRISPRCasFinder,CRT 5248673-5248704 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 NC_004813 Enterobacteria phage BP-4795, complete genome 54813-54844 8 0.75
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 AJ556162 Phage BP-4795 complete genome 54813-54844 8 0.75
CP027766_7 7.3|5248490|32|CP027766|PILER-CR,CRISPRCasFinder,CRT 5248490-5248521 32 NZ_CP009293 Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence 271059-271090 8 0.75
CP027766_7 7.4|5248551|32|CP027766|PILER-CR,CRISPRCasFinder,CRT 5248551-5248582 32 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1022602-1022633 8 0.75
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 NZ_CP033971 Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence 196702-196733 9 0.719
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 NZ_CP032536 Bacillus megaterium NCT-2 plasmid pNCT2_8, complete sequence 12244-12275 9 0.719
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 HQ634174 Cyanophage MED4-213, complete genome 147764-147795 9 0.719
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 GU075905 Prochlorococcus phage P-HM2, complete genome 150138-150169 9 0.719
CP027766_4 4.1|2108327|32|CP027766|CRISPRCasFinder 2108327-2108358 32 GU071101 Prochlorococcus phage P-HM1, complete genome 145480-145511 9 0.719
CP027766_7 7.4|5248551|32|CP027766|PILER-CR,CRISPRCasFinder,CRT 5248551-5248582 32 MT932212 Salmonella phage VSe13, complete genome 11034-11065 9 0.719
CP027766_7 7.2|5248429|32|CP027766|PILER-CR,CRISPRCasFinder,CRT 5248429-5248460 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 903982-904013 10 0.688
CP027766_3 3.1|2072165|58|CP027766|CRISPRCasFinder 2072165-2072222 58 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7432-7489 11 0.81
CP027766_3 3.1|2072165|58|CP027766|CRISPRCasFinder 2072165-2072222 58 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84256-84313 11 0.81
CP027766_7 7.2|5248429|32|CP027766|PILER-CR,CRISPRCasFinder,CRT 5248429-5248460 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1467285-1467316 11 0.656

1. spacer 2.1|1570448|40|CP027766|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to NC_004813 (Enterobacteria phage BP-4795, complete genome) position: , mismatch: 0, identity: 1.0 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacatctgctgcaacatccgctgcat	Protospacer
********************************

3. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to AJ556162 (Phage BP-4795 complete genome) position: , mismatch: 0, identity: 1.0 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacatctgctgcaacatccgctgcat	Protospacer
********************************

4. spacer 1.1|871729|38|CP027766|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

5. spacer 3.1|2072165|58|CP027766|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 5, identity: 0.914 

agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattcag	CRISPR spacer
agacccgagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgatcgt	Protospacer
*********************** ****************************. **.

6. spacer 7.6|5248673|32|CP027766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

cggctatggaatttatggagaagtttggtttt	CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat	Protospacer
*  ************** ********.**  *

7. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to NC_004813 (Enterobacteria phage BP-4795, complete genome) position: , mismatch: 8, identity: 0.75 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
gactattgcatctgctgcaacatctgctgcaa	Protospacer
 .**.. .****************.******

8. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to AJ556162 (Phage BP-4795 complete genome) position: , mismatch: 8, identity: 0.75 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
gactattgcatctgctgcaacatctgctgcaa	Protospacer
 .**.. .****************.******

9. spacer 7.3|5248490|32|CP027766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009293 (Novosphingobium pentaromativorans US6-1 plasmid pLA4, complete sequence) position: , mismatch: 8, identity: 0.75 

------ccgggatattgcccaccagctccgctactgtt	CRISPR spacer
gtctatccg------tgcccaccagctccgctcctttt	Protospacer
      ***      ***************** ** **

10. spacer 7.4|5248551|32|CP027766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75 

cagctcgcagcgctcggaacgtggcgctatag	CRISPR spacer
gagatcgcagcgctcggaccgtggttccacaa	Protospacer
 ** ************** *****. *.*.*.

11. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
cgcctggccacctgctgcaacatgcgctgcac	Protospacer
.**.  . **.************ *******.

12. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to NZ_CP032536 (Bacillus megaterium NCT-2 plasmid pNCT2_8, complete sequence) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgcttcaacatctgcttcaacatgagaagtca	Protospacer
**** *********** ******  *  *.

13. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to HQ634174 (Cyanophage MED4-213, complete genome) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacagctgctgctacattcacattga	Protospacer
********** ******* ****.*.*  ..

14. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacagctgctgctacattcacattga	Protospacer
********** ******* ****.*.*  ..

15. spacer 4.1|2108327|32|CP027766|CRISPRCasFinder matches to GU071101 (Prochlorococcus phage P-HM1, complete genome) position: , mismatch: 9, identity: 0.719 

tgctgcaacatctgctgcaacatccgctgcat	CRISPR spacer
tgctgcaacagctgctgctacattcacattga	Protospacer
********** ******* ****.*.*  ..

16. spacer 7.4|5248551|32|CP027766|PILER-CR,CRISPRCasFinder,CRT matches to MT932212 (Salmonella phage VSe13, complete genome) position: , mismatch: 9, identity: 0.719 

cagctcgcagcgctcggaacgtggcgctatag	CRISPR spacer
aaaacatcagcgctcagaacgcggcgctatcg	Protospacer
 *. .  ********.*****.******** *

17. spacer 7.2|5248429|32|CP027766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
gcgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
*. **** ***************.**..   .

18. spacer 3.1|2072165|58|CP027766|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 11, identity: 0.81 

---agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattca	CRISPR spacer
acaaaact---gcactcaaccgtaggccggataaggcgttcacgccgcatccggcaattg	Protospacer
   *.**.   ****  *************************************** *..

19. spacer 3.1|2072165|58|CP027766|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 11, identity: 0.81 

---agacccgagcacagaaccgtaggccggataaggcgttcacgccgcatccggcattca	CRISPR spacer
acaaaact---gcactcaaccgtaggccggataaggcgttcacgccgcatccggcaattg	Protospacer
   *.**.   ****  *************************************** *..

20. spacer 7.2|5248429|32|CP027766|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

gtccatggcctgacgaagctcgtaatattttg	CRISPR spacer
ccgcatgtcctgacgaagctcgtgatgcaaga	Protospacer
 . **** ***************.**..   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage