Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028324 Massilia sp. ZMN-3 chromosome, complete genome 12 crisprs WYL,csa3,DEDDh,DinG,cas3 1 3 3 0

Results visualization

1. CP028324
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_1 130289-130395 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_2 563276-563466 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_3 802285-802367 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_4 959219-959308 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_5 1557314-1557425 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_6 1885962-1886083 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_7 3193063-3193156 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_8 3837880-3837983 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_9 3920263-3920367 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_11 4692259-4692349 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_12 5265317-5265419 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028324_13 5382040-5382134 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP028324_7 7.1|3193092|36|CP028324|CRISPRCasFinder 3193092-3193127 36 CP028324.1 4333928-4333963 2 0.944

1. spacer 7.1|3193092|36|CP028324|CRISPRCasFinder matches to position: 4333928-4333963, mismatch: 2, identity: 0.944

gaaacgggacacgagcccggccgttgcaatagttca	CRISPR spacer
gaaacgagacacgagcccggccgttgcgatagttca	Protospacer
******.********************.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028324_1 1.1|130330|25|CP028324|CRISPRCasFinder 130330-130354 25 NZ_CP046706 Nostoc sp. ATCC 53789 plasmid pNsp_c, complete sequence 140438-140462 5 0.8
CP028324_2 2.1|563320|30|CP028324|CRISPRCasFinder 563320-563349 30 NZ_CP045339 Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence 239068-239097 6 0.8
CP028324_2 2.2|563394|29|CP028324|CRISPRCasFinder 563394-563422 29 NZ_CP032325 Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence 326346-326374 8 0.724
CP028324_2 2.2|563394|29|CP028324|CRISPRCasFinder 563394-563422 29 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 384635-384663 8 0.724

1. spacer 1.1|130330|25|CP028324|CRISPRCasFinder matches to NZ_CP046706 (Nostoc sp. ATCC 53789 plasmid pNsp_c, complete sequence) position: , mismatch: 5, identity: 0.8

gcggcagtgattgatggctgagctt	CRISPR spacer
tgttcagtgattgatggttgagctt	Protospacer
    *************.*******

2. spacer 2.1|563320|30|CP028324|CRISPRCasFinder matches to NZ_CP045339 (Vibrio sp. THAF190c plasmid pTHAF190c_a, complete sequence) position: , mismatch: 6, identity: 0.8

cgacggtactccacagacctacgcctcagt	CRISPR spacer
cgacggtaatccaaagacctacgaaacagg	Protospacer
******** **** *********   *** 

3. spacer 2.2|563394|29|CP028324|CRISPRCasFinder matches to NZ_CP032325 (Azospirillum brasilense strain MTCC4035 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.724

ggagcgtacgcaggcgactacagccgggc	CRISPR spacer
ctttccgtcgccggcgactacagccgggc	Protospacer
    *   *** *****************

4. spacer 2.2|563394|29|CP028324|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.724

ggagcgtacgcaggcgactacagccgggc	CRISPR spacer
ctttccgtcgccggcgactacagccgggc	Protospacer
    *   *** *****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3387822 : 3452928 42 Escherichia_phage(25.0%) plate,transposase,protease NA
DBSCAN-SWA_2 5663518 : 5671672 8 Caulobacter_phage(16.67%) tRNA NA
DBSCAN-SWA_3 5734926 : 5742652 9 Acinetobacter_phage(66.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage