Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027701 Escherichia coli strain 675SK2 chromosome, complete genome 6 crisprs DEDDh,c2c9_V-U4,RT,DinG,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 9 7 0
CP027703 Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence 0 crisprs csa3,RT 0 0 2 0

Results visualization

1. CP027701
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027701_1 650862-651011 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027701_2 826568-826699 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027701_3 1239361-1239505 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027701_4 1379548-1379644 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027701_5 3828690-3828962 TypeI-E I-E
4 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027701_6 3857449-3858026 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027701_2 2.2|826642|42|CP027701|PILER-CR 826642-826683 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 0 1.0
CP027701_5 5.1|3828719|32|CP027701|CRT 3828719-3828750 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 0 1.0
CP027701_6 6.7|3857844|32|CP027701|CRISPRCasFinder,CRT,PILER-CR 3857844-3857875 32 NC_016040 Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence 37866-37897 6 0.812
CP027701_5 5.1|3828719|32|CP027701|CRT 3828719-3828750 32 MK455769 Aeromonas phage MJG, complete genome 10369-10400 7 0.781
CP027701_6 6.5|3857722|32|CP027701|CRISPRCasFinder,CRT,PILER-CR 3857722-3857753 32 KC821619 Cellulophaga phage phi18:1, complete genome 6924-6955 7 0.781
CP027701_6 6.5|3857722|32|CP027701|CRISPRCasFinder,CRT,PILER-CR 3857722-3857753 32 KC821627 Cellulophaga phage phi18:2, complete genome 6924-6955 7 0.781
CP027701_5 5.1|3828719|32|CP027701|CRT 3828719-3828750 32 NZ_CP028965 Burkholderia sp. IDO3 plasmid p1, complete sequence 163306-163337 8 0.75
CP027701_5 5.3|3828841|32|CP027701|CRT,PILER-CR 3828841-3828872 32 NZ_CP044084 Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence 347859-347890 8 0.75
CP027701_6 6.6|3857783|32|CP027701|CRISPRCasFinder,CRT,PILER-CR 3857783-3857814 32 MN855878 Bacteriophage sp. isolate 336, complete genome 5171-5202 8 0.75
CP027701_6 6.9|3857966|32|CP027701|CRISPRCasFinder,CRT,PILER-CR 3857966-3857997 32 NZ_CP045381 Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence 107507-107538 8 0.75
CP027701_6 6.9|3857966|32|CP027701|CRISPRCasFinder,CRT,PILER-CR 3857966-3857997 32 NZ_CP019631 Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence 199281-199312 8 0.75
CP027701_5 5.1|3828719|32|CP027701|CRT 3828719-3828750 32 NC_047954 Pseudomonas phage Njord, complete genome 11435-11466 9 0.719
CP027701_5 5.2|3828780|32|CP027701|CRT,PILER-CR 3828780-3828811 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 11267-11298 9 0.719
CP027701_6 6.5|3857722|32|CP027701|CRISPRCasFinder,CRT,PILER-CR 3857722-3857753 32 NZ_CP020483 Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence 383-414 9 0.719
CP027701_3 3.1|1239404|59|CP027701|CRISPRCasFinder 1239404-1239462 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
CP027701_5 5.1|3828719|32|CP027701|CRT 3828719-3828750 32 NC_047894 Pseudomonas phage uligo, complete genome 11353-11384 10 0.688
CP027701_3 3.1|1239404|59|CP027701|CRISPRCasFinder 1239404-1239462 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814

1. spacer 2.2|826642|42|CP027701|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0 

gaacttaacaatattgaaagttggatttatctgcgtgtgaca	CRISPR spacer
gaacttaacaatattgaaagttggatttatctgcgtgtgaca	Protospacer
******************************************

2. spacer 5.1|3828719|32|CP027701|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 0, identity: 1.0 

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
********************************

3. spacer 6.7|3857844|32|CP027701|CRISPRCasFinder,CRT,PILER-CR matches to NC_016040 (Sulfobacillus thermotolerans strain Y0017 plasmid pY0017, complete sequence) position: , mismatch: 6, identity: 0.812 

gagagcgaggggagattccggcagggcgtgca	CRISPR spacer
aatcgtgaggggatcttccggcagggcgtgca	Protospacer
.*  *.*******  *****************

4. spacer 5.1|3828719|32|CP027701|CRT matches to MK455769 (Aeromonas phage MJG, complete genome) position: , mismatch: 7, identity: 0.781 

-caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcctccgat-tccatcattgcatacagtgcgtc	Protospacer
 *   .*** ********.**** *********

5. spacer 6.5|3857722|32|CP027701|CRISPRCasFinder,CRT,PILER-CR matches to KC821619 (Cellulophaga phage phi18:1, complete genome) position: , mismatch: 7, identity: 0.781 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****

6. spacer 6.5|3857722|32|CP027701|CRISPRCasFinder,CRT,PILER-CR matches to KC821627 (Cellulophaga phage phi18:2, complete genome) position: , mismatch: 7, identity: 0.781 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
gcggttttattttccctgaaaagaaaaaagag	Protospacer
** *. **************** ** ****

7. spacer 5.1|3828719|32|CP027701|CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcacaggtgtcgatcatcgcatccagcgcgtg	Protospacer
  *  *.**** **************.****

8. spacer 5.3|3828841|32|CP027701|CRT,PILER-CR matches to NZ_CP044084 (Pseudomonas luteola strain FDAARGOS_637 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gttgaggtcgataagtacgaacggtttccctg	CRISPR spacer
gaagaggtcgatgagtacgaatggttacagcg	Protospacer
*  *********.********.**** *  .*

9. spacer 6.6|3857783|32|CP027701|CRISPRCasFinder,CRT,PILER-CR matches to MN855878 (Bacteriophage sp. isolate 336, complete genome) position: , mismatch: 8, identity: 0.75 

taatatccc----tggcgataatcaaccggcttact	CRISPR spacer
----acgccatggtggcgataatcatcctgcttact	Protospacer
    *. **    ************ ** *******

10. spacer 6.9|3857966|32|CP027701|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75 

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.*

11. spacer 6.9|3857966|32|CP027701|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

aaggtcgcggggacgccacgggcagtcaatgt	CRISPR spacer
gatttcgctgggaccccacgggcagtcgacgg	Protospacer
.*  **** ***** ************.*.*

12. spacer 5.1|3828719|32|CP027701|CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 9, identity: 0.719 

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcctcggcctccatcatcgcatcgagtgcgtc	Protospacer
    .*.. ************** ********

13. spacer 5.2|3828780|32|CP027701|CRT,PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

gtcaataggcggcgtcccgtagccgtcccctt	CRISPR spacer
gtgctctggcggcgtgccgtagccatccccga	Protospacer
**   . ******** ********.*****

14. spacer 6.5|3857722|32|CP027701|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020483 (Campylobacter helveticus strain ATCC 51209 plasmid pHELV-5, complete sequence) position: , mismatch: 9, identity: 0.719 

gccgcgttattttccctgaaaacaataaagct	CRISPR spacer
tagcctttattttcactcaaaacaataaaagt	Protospacer
    * ******** ** ***********. *

15. spacer 3.1|1239404|59|CP027701|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831 

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.*

16. spacer 5.1|3828719|32|CP027701|CRT matches to NC_047894 (Pseudomonas phage uligo, complete genome) position: , mismatch: 10, identity: 0.688 

caagtgatgtccatcatcgcatccagtgcgtc	CRISPR spacer
gcttctgcctccatcatcgcatcgagtgcgtc	Protospacer
    . .. ************** ********

17. spacer 3.1|1239404|59|CP027701|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814 

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 980830 : 1053670 60 Emiliania_huxleyi_virus(11.11%) protease,plate,tRNA,transposase NA
DBSCAN-SWA_2 1745295 : 1782518 31 Stx2-converting_phage(42.86%) integrase,protease,transposase attL 1735032:1735047|attR 1764451:1764466
DBSCAN-SWA_3 2080263 : 2137615 66 Escherichia_phage(43.48%) tRNA,protease,transposase,terminase,holin,integrase,tail,head,capsid,portal attL 2075358:2075372|attR 2081838:2081852
DBSCAN-SWA_4 3049110 : 3055539 6 Escherichia_phage(33.33%) NA NA
DBSCAN-SWA_5 3143306 : 3150237 9 Enterobacteria_phage(66.67%) transposase NA
DBSCAN-SWA_6 3661062 : 3767517 109 Erwinia_phage(21.57%) lysis,tRNA,transposase,plate,terminase,tail,integrase,holin,head,capsid,portal attL 3655370:3655385|attR 3762876:3762891
DBSCAN-SWA_7 3803818 : 3810958 6 Escherichia_phage(83.33%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP027703
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 22564 : 63344 43 Escherichia_phage(42.86%) transposase,integrase attL 54876:54935|attR 67391:68211
DBSCAN-SWA_2 66681 : 98858 35 Escherichia_phage(28.57%) transposase,protease NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage