Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028584 Pseudomonas aeruginosa strain WCHPA075019 chromosome, complete genome 1 crisprs csa3,RT,WYL,DEDDh,cas3,DinG 0 1 6 0

Results visualization

1. CP028584
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028584_1 2091029-2091130 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028584_1 1.1|2091054|52|CP028584|CRISPRCasFinder 2091054-2091105 52 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63842 0 1.0

1. spacer 1.1|2091054|52|CP028584|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 0, identity: 1.0

tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	CRISPR spacer
tccggcgttattcgccctacgcggagggttcccagctttcgctccgccgttg	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 631904 : 714369 80 Pseudomonas_phage(39.53%) holin,plate,tail,tRNA,transposase NA
DBSCAN-SWA_2 870267 : 903563 28 Wolbachia_phage(25.0%) integrase,transposase attL 872670:872685|attR 913883:913898
DBSCAN-SWA_3 1668998 : 1678026 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 2913607 : 2920501 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_5 5199168 : 5206660 12 Pseudomonas_phage(100.0%) integrase attL 5196121:5196135|attR 5203789:5203803
DBSCAN-SWA_6 5801940 : 5850048 35 uncultured_Mediterranean_phage(33.33%) integrase,coat,tRNA attL 5827994:5828009|attR 5855984:5855999
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage