Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024869 Dietzia sp. JS16-p6b chromosome, complete genome 2 crisprs DEDDh,cas3,DinG,csa3,WYL,cas4,RT 0 3 1 0

Results visualization

1. CP024869
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024869_2 1458922-1459015 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024869_3 2917241-2917327 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 125533-125566 8 0.765
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1093558-1093591 8 0.765
CP024869_1 1.5|729973|34|CP024869|CRT 729973-730006 34 NZ_CP014684 Kozakia baliensis strain NBRC 16680 plasmid pKB16680_3, complete sequence 4423-4456 8 0.765
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 707219-707252 9 0.735
CP024869_1 1.3|729838|34|CP024869|CRT 729838-729871 34 NZ_CP013855 Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence 125533-125566 9 0.735
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1514102-1514135 10 0.706
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1135823-1135856 10 0.706
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1537471-1537504 10 0.706
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 379506-379539 10 0.706
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1442318-1442351 10 0.706
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 6499-6532 10 0.706
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1752886-1752919 10 0.706
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 MF415411 Klebsiella phage KPN U2874, complete genome 261-294 11 0.676
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 MF476924 Klebsiella phage YMC15/11/N53_KPN_BP, complete genome 261-294 11 0.676
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 MF415413 Klebsiella phage KPN N54, complete genome 261-294 11 0.676
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 MF415410 Klebsiella phage KPN N137, complete genome 261-294 11 0.676
CP024869_1 1.2|729766|34|CP024869|CRT 729766-729799 34 MG835858 Klebsiella phage KPN N98, complete genome 261-294 11 0.676

1. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.765

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
ggtggacagcggcggcatcccggcccgcgccatc	Protospacer
************** *********  .  * *.*

2. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.765

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
ggtggacagcgccgccaacccggcaccacgcatc	Protospacer
*********** ***** ******.  **  *.*

3. spacer 1.5|729973|34|CP024869|CRT matches to NZ_CP014684 (Kozakia baliensis strain NBRC 16680 plasmid pKB16680_3, complete sequence) position: , mismatch: 8, identity: 0.765

ggtggacagcggtgccatgccgagcgagccgatg	CRISPR spacer
catggacagcgttgccatgccgaacgacaggctg	Protospacer
 .********* ***********.***   * **

4. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 9, identity: 0.735

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
gatcaattgcggcgcgatcccggcgggaccgagt	Protospacer
*.* .*. ******* **********.***** .

5. spacer 1.3|729838|34|CP024869|CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.735

ggtggacagtggcgccatcccggcggaaccgacc	CRISPR spacer
ggtggacagcggcggcatcccggcccgcgccatc	Protospacer
*********.**** *********  .  * *.*

6. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
tccggacagcggcgccgtcctggcggagcggcag	Protospacer
  .*************.***.******.* *   

7. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.706

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
tccggacagcggcgccgtcctggcggagcggcag	Protospacer
  .*************.***.******.* *   

8. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.706

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
tccggacagcggcgccgtcctggcggagcggcag	Protospacer
  .*************.***.******.* *   

9. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
tccggacagcggcgccgtcctggcggagcggcag	Protospacer
  .*************.***.******.* *   

10. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
tccggacagcggcgccgtcctggcggagcggcag	Protospacer
  .*************.***.******.* *   

11. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.706

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
tccggacagcggcgccgtcctggcggagcggcag	Protospacer
  .*************.***.******.* *   

12. spacer 1.2|729766|34|CP024869|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.706

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
tccggacagcggcgccgtcctggcggagcggcag	Protospacer
  .*************.***.******.* *   

13. spacer 1.2|729766|34|CP024869|CRT matches to MF415411 (Klebsiella phage KPN U2874, complete genome) position: , mismatch: 11, identity: 0.676

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
ccgccccatcggcgccatccccgcggaaccaata	Protospacer
      ** ************ ********.*. 

14. spacer 1.2|729766|34|CP024869|CRT matches to MF476924 (Klebsiella phage YMC15/11/N53_KPN_BP, complete genome) position: , mismatch: 11, identity: 0.676

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
ccgccccatcggcgccatccccgcggaaccaata	Protospacer
      ** ************ ********.*. 

15. spacer 1.2|729766|34|CP024869|CRT matches to MF415413 (Klebsiella phage KPN N54, complete genome) position: , mismatch: 11, identity: 0.676

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
ccgccccatcggcgccatccccgcggaaccaata	Protospacer
      ** ************ ********.*. 

16. spacer 1.2|729766|34|CP024869|CRT matches to MF415410 (Klebsiella phage KPN N137, complete genome) position: , mismatch: 11, identity: 0.676

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
ccgccccatcggcgccatccccgcggaaccaata	Protospacer
      ** ************ ********.*. 

17. spacer 1.2|729766|34|CP024869|CRT matches to MG835858 (Klebsiella phage KPN N98, complete genome) position: , mismatch: 11, identity: 0.676

ggtggacagcggcgccatcccggcggaaccgacc	CRISPR spacer
ccgccccatcggcgccatccccgcggaaccaata	Protospacer
      ** ************ ********.*. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2308527 : 2362100 37 Staphylococcus_phage(20.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage