Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 2 crisprs Cas14u_CAS-V,RT 0 13 0 0
CP020114 Nodularia spumigena UHCC 0039 chromosome, complete genome 13 crisprs cas14j,Cas9_archaeal,c2c9_V-U4,cas14k,csa3,PD-DExK,RT,DinG,Cas14c_CAS-V-F,2OG_CAS,WYL,cas2,cas1,csm6,cas6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,csx3 2 5 0 0

Results visualization

1. CP020115
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020115_1 36321-36903 Unclear NA
9 spacers
Cas14u_CAS-V,RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020115_2 45845-46095 Orphan NA
4 spacers
RT,Cas14u_CAS-V

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP020115_1 1.1|36349|35|CP020115|CRT 36349-36383 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36349-36383 0 1.0
CP020115_1 1.1|36349|35|CP020115|CRT 36349-36383 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36718-36752 0 1.0
CP020115_1 1.2|36412|32|CP020115|CRT 36412-36443 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36412-36443 0 1.0
CP020115_1 1.2|36412|32|CP020115|CRT 36412-36443 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36535-36566 0 1.0
CP020115_1 1.2|36412|32|CP020115|CRT 36412-36443 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36658-36689 0 1.0
CP020115_1 1.2|36412|32|CP020115|CRT 36412-36443 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36781-36812 0 1.0
CP020115_1 1.3|36472|35|CP020115|CRT 36472-36506 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36472-36506 0 1.0
CP020115_1 1.3|36472|35|CP020115|CRT 36472-36506 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36841-36875 0 1.0
CP020115_1 1.4|36535|32|CP020115|CRT 36535-36566 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36412-36443 0 1.0
CP020115_1 1.4|36535|32|CP020115|CRT 36535-36566 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36535-36566 0 1.0
CP020115_1 1.4|36535|32|CP020115|CRT 36535-36566 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36658-36689 0 1.0
CP020115_1 1.4|36535|32|CP020115|CRT 36535-36566 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36781-36812 0 1.0
CP020115_1 1.5|36595|35|CP020115|CRT 36595-36629 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36595-36629 0 1.0
CP020115_1 1.6|36658|32|CP020115|CRT 36658-36689 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36412-36443 0 1.0
CP020115_1 1.6|36658|32|CP020115|CRT 36658-36689 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36535-36566 0 1.0
CP020115_1 1.6|36658|32|CP020115|CRT 36658-36689 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36658-36689 0 1.0
CP020115_1 1.6|36658|32|CP020115|CRT 36658-36689 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36781-36812 0 1.0
CP020115_1 1.7|36718|35|CP020115|CRT 36718-36752 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36349-36383 0 1.0
CP020115_1 1.7|36718|35|CP020115|CRT 36718-36752 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36718-36752 0 1.0
CP020115_1 1.8|36781|32|CP020115|CRT 36781-36812 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36412-36443 0 1.0
CP020115_1 1.8|36781|32|CP020115|CRT 36781-36812 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36535-36566 0 1.0
CP020115_1 1.8|36781|32|CP020115|CRT 36781-36812 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36658-36689 0 1.0
CP020115_1 1.8|36781|32|CP020115|CRT 36781-36812 32 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36781-36812 0 1.0
CP020115_1 1.9|36841|35|CP020115|CRT 36841-36875 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36472-36506 0 1.0
CP020115_1 1.9|36841|35|CP020115|CRT 36841-36875 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36841-36875 0 1.0
CP020115_2 2.1|45868|50|CP020115|CRISPRCasFinder 45868-45917 50 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 45868-45917 0 1.0
CP020115_2 2.2|45941|24|CP020115|CRISPRCasFinder 45941-45964 24 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 45941-45964 0 1.0
CP020115_2 2.3|45988|25|CP020115|CRISPRCasFinder 45988-46012 25 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 45988-46012 0 1.0
CP020115_2 2.4|46036|37|CP020115|CRISPRCasFinder 46036-46072 37 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 46036-46072 0 1.0
CP020115_1 1.1|36349|35|CP020115|CRT 36349-36383 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36595-36629 1 0.971
CP020115_1 1.3|36472|35|CP020115|CRT 36472-36506 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36595-36629 1 0.971
CP020115_1 1.5|36595|35|CP020115|CRT 36595-36629 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36349-36383 1 0.971
CP020115_1 1.5|36595|35|CP020115|CRT 36595-36629 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36472-36506 1 0.971
CP020115_1 1.5|36595|35|CP020115|CRT 36595-36629 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36718-36752 1 0.971
CP020115_1 1.5|36595|35|CP020115|CRT 36595-36629 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36841-36875 1 0.971
CP020115_1 1.7|36718|35|CP020115|CRT 36718-36752 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36595-36629 1 0.971
CP020115_1 1.9|36841|35|CP020115|CRT 36841-36875 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36595-36629 1 0.971
CP020115_1 1.1|36349|35|CP020115|CRT 36349-36383 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36472-36506 2 0.943
CP020115_1 1.1|36349|35|CP020115|CRT 36349-36383 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36841-36875 2 0.943
CP020115_1 1.3|36472|35|CP020115|CRT 36472-36506 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36349-36383 2 0.943
CP020115_1 1.3|36472|35|CP020115|CRT 36472-36506 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36718-36752 2 0.943
CP020115_1 1.7|36718|35|CP020115|CRT 36718-36752 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36472-36506 2 0.943
CP020115_1 1.7|36718|35|CP020115|CRT 36718-36752 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36841-36875 2 0.943
CP020115_1 1.9|36841|35|CP020115|CRT 36841-36875 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36349-36383 2 0.943
CP020115_1 1.9|36841|35|CP020115|CRT 36841-36875 35 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36718-36752 2 0.943
CP020115_2 2.2|45941|24|CP020115|CRISPRCasFinder 45941-45964 24 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 1213582-1213605 3 0.875
CP020115_2 2.2|45941|24|CP020115|CRISPRCasFinder 45941-45964 24 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1223061-1223084 3 0.875
CP020115_2 2.2|45941|24|CP020115|CRISPRCasFinder 45941-45964 24 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 864288-864311 3 0.875

1. spacer 1.1|36349|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
***********************************

2. spacer 1.1|36349|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
***********************************

3. spacer 1.2|36412|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

4. spacer 1.2|36412|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

5. spacer 1.2|36412|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

6. spacer 1.2|36412|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

7. spacer 1.3|36472|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
***********************************

8. spacer 1.3|36472|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
***********************************

9. spacer 1.4|36535|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

10. spacer 1.4|36535|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

11. spacer 1.4|36535|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

12. spacer 1.4|36535|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

13. spacer 1.5|36595|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcgggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaactcg	Protospacer
***********************************

14. spacer 1.6|36658|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

15. spacer 1.6|36658|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

16. spacer 1.6|36658|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

17. spacer 1.6|36658|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

18. spacer 1.7|36718|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
***********************************

19. spacer 1.7|36718|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
***********************************

20. spacer 1.8|36781|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

21. spacer 1.8|36781|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

22. spacer 1.8|36781|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

23. spacer 1.8|36781|32|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gttttcaagaaggggagcgcgcgaaagatata	CRISPR spacer
gttttcaagaaggggagcgcgcgaaagatata	Protospacer
********************************

24. spacer 1.9|36841|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
***********************************

25. spacer 1.9|36841|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
***********************************

26. spacer 2.1|45868|50|CP020115|CRISPRCasFinder matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

cttgagtgcgatgggcaaagccccgccgtaggcgatcgccactgataact	CRISPR spacer
cttgagtgcgatgggcaaagccccgccgtaggcgatcgccactgataact	Protospacer
**************************************************

27. spacer 2.2|45941|24|CP020115|CRISPRCasFinder matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

gctactcctgcggtgcgctcatca	CRISPR spacer
gctactcctgcggtgcgctcatca	Protospacer
************************

28. spacer 2.3|45988|25|CP020115|CRISPRCasFinder matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

tgcgagttctgcggtgcgctcatca	CRISPR spacer
tgcgagttctgcggtgcgctcatca	Protospacer
*************************

29. spacer 2.4|46036|37|CP020115|CRISPRCasFinder matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

agtgtgagtgtttgtacctatgtcccatgtcccaact	CRISPR spacer
agtgtgagtgtttgtacctatgtcccatgtcccaact	Protospacer
*************************************

30. spacer 1.1|36349|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcgggagggggatgatctcaccattaactcg	Protospacer
********************************.**

31. spacer 1.3|36472|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaactcg	Protospacer
******.****************************

32. spacer 1.5|36595|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcgggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
********************************.**

33. spacer 1.5|36595|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcgggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
******.****************************

34. spacer 1.5|36595|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcgggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
********************************.**

35. spacer 1.5|36595|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcgggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
******.****************************

36. spacer 1.7|36718|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcgggagggggatgatctcaccattaactcg	Protospacer
********************************.**

37. spacer 1.9|36841|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.971

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaactcg	Protospacer
******.****************************

38. spacer 1.1|36349|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
******.*************************.**

39. spacer 1.1|36349|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
******.*************************.**

40. spacer 1.3|36472|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
******.*************************.**

41. spacer 1.3|36472|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
******.*************************.**

42. spacer 1.7|36718|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
******.*************************.**

43. spacer 1.7|36718|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcgggagggggatgatctcaccattaacccg	CRISPR spacer
attgtcaggagggggatgatctcaccattaactcg	Protospacer
******.*************************.**

44. spacer 1.9|36841|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
******.*************************.**

45. spacer 1.9|36841|35|CP020115|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.943

attgtcaggagggggatgatctcaccattaactcg	CRISPR spacer
attgtcgggagggggatgatctcaccattaacccg	Protospacer
******.*************************.**

46. spacer 2.2|45941|24|CP020115|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 3, identity: 0.875

gctactcctgcggtgcgctcatca	CRISPR spacer
gttcctcctgcggtgcgctcatcg	Protospacer
*.* *******************.

47. spacer 2.2|45941|24|CP020115|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 3, identity: 0.875

gctactcctgcggtgcgctcatca	CRISPR spacer
gttcctcctgcggtgcgctcatcg	Protospacer
*.* *******************.

48. spacer 2.2|45941|24|CP020115|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 3, identity: 0.875

gctactcctgcggtgcgctcatca	CRISPR spacer
gttcctcctgcggtgcgctcatcg	Protospacer
*.* *******************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP020114
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_1 389582-389677 orTypeII NA
1 spacers
Cas9_archaeal

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_2 725890-726003 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_4 860769-860869 TypeV-U4 NA
1 spacers
c2c9_V-U4

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_5 952478-953238 Orphan NA
10 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_6 965199-965296 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_8 1521840-1521967 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_9 1986659-1986771 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_10 2515639-2515717 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_11 2651429-2651528 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_12 4035453-4037321 TypeIII-A NA
24 spacers
WYL,cas2,cas1,csm6,cas6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_13 4039199-4039298 TypeIII-A NA
1 spacers
cas1,cas2,WYL,csm6,cas6,csm5gr7,csm4gr5,csm3gr7,csm2gr11,cas10,csx3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_14 4154495-4154587 Unclear NA
1 spacers
cas6

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP020114_15 4979869-4980088 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 970767-970803 1 0.973
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 970843-970879 1 0.973
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 970729-970765 2 0.946
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 970805-970841 2 0.946
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 1323736-1323772 2 0.946
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 3205368-3205404 2 0.946
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 3205406-3205442 2 0.946
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 3205444-3205480 2 0.946
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 3205482-3205518 2 0.946
CP020114_9 9.1|1986697|37|CP020114|CRISPRCasFinder 1986697-1986733 37 CP020114.1 3205520-3205556 2 0.946
CP020114_14 14.1|4154519|45|CP020114|CRISPRCasFinder 4154519-4154563 45 CP020114.1 1075330-1075374 1 0.978
CP020114_14 14.1|4154519|45|CP020114|CRISPRCasFinder 4154519-4154563 45 CP020114.1 5068473-5068517 1 0.978

1. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 970767-970803, mismatch: 1, identity: 0.973

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcccccctgcctcttctcccccctgcaccctg	Protospacer
******************** ****************

2. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 970843-970879, mismatch: 1, identity: 0.973

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcccccctgcctcttctcccccctgcaccctg	Protospacer
******************** ****************

3. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 970729-970765, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcccccctgcctcttcccccccctgcaccctg	Protospacer
******************** .***************

4. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 970805-970841, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcccccctgcctcttcccccccctgcaccctg	Protospacer
******************** .***************

5. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 1323736-1323772, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgctcccctgcctcttctcccccctgcaccctg	Protospacer
*******.************ ****************

6. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 3205368-3205404, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcacccctgcctcttctcccccctgcaccctg	Protospacer
******* ************ ****************

7. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 3205406-3205442, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcacccctgcctcttctcccccctgcaccctg	Protospacer
******* ************ ****************

8. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 3205444-3205480, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcacccctgcctcttctcccccctgcaccctg	Protospacer
******* ************ ****************

9. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 3205482-3205518, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcacccctgcctcttctcccccctgcaccctg	Protospacer
******* ************ ****************

10. spacer 9.1|1986697|37|CP020114|CRISPRCasFinder matches to position: 3205520-3205556, mismatch: 2, identity: 0.946

accctgcccccctgcctcttgtcccccctgcaccctg	CRISPR spacer
accctgcacccctgcctcttctcccccctgcaccctg	Protospacer
******* ************ ****************

11. spacer 14.1|4154519|45|CP020114|CRISPRCasFinder matches to position: 1075330-1075374, mismatch: 1, identity: 0.978

ccccaacccctttccttgctttcgcgtagcgtctccctttgggag	CRISPR spacer
ccccaacccctctccttgctttcgcgtagcgtctccctttgggag	Protospacer
***********.*********************************

12. spacer 14.1|4154519|45|CP020114|CRISPRCasFinder matches to position: 5068473-5068517, mismatch: 1, identity: 0.978

ccccaacccctttccttgctttcgcgtagcgtctccctttgggag	CRISPR spacer
ccccaacccctctccttgctttcgcgtagcgtctccctttgggag	Protospacer
***********.*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP020114_15 15.3|4980026|29|CP020114|CRT 4980026-4980054 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36478-36506 0 1.0
CP020114_15 15.3|4980026|29|CP020114|CRT 4980026-4980054 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36847-36875 0 1.0
CP020114_15 15.1|4979903|29|CP020114|CRT 4979903-4979931 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36601-36629 1 0.966
CP020114_15 15.3|4980026|29|CP020114|CRT 4980026-4980054 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36601-36629 1 0.966
CP020114_15 15.1|4979903|29|CP020114|CRT 4979903-4979931 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36478-36506 2 0.931
CP020114_15 15.1|4979903|29|CP020114|CRT 4979903-4979931 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36847-36875 2 0.931
CP020114_15 15.1|4979903|29|CP020114|CRT 4979903-4979931 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36355-36383 2 0.931
CP020114_15 15.1|4979903|29|CP020114|CRT 4979903-4979931 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36724-36752 2 0.931
CP020114_15 15.3|4980026|29|CP020114|CRT 4980026-4980054 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36355-36383 2 0.931
CP020114_15 15.3|4980026|29|CP020114|CRT 4980026-4980054 29 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36724-36752 2 0.931
CP020114_15 15.2|4979966|26|CP020114|CRT 4979966-4979991 26 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36418-36443 4 0.846
CP020114_15 15.2|4979966|26|CP020114|CRT 4979966-4979991 26 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36541-36566 4 0.846
CP020114_15 15.2|4979966|26|CP020114|CRT 4979966-4979991 26 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36664-36689 4 0.846
CP020114_15 15.2|4979966|26|CP020114|CRT 4979966-4979991 26 NZ_CP020115 Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence 36787-36812 4 0.846
CP020114_15 15.1|4979903|29|CP020114|CRT 4979903-4979931 29 NZ_CP029555 Chromobacterium sp. IIBBL 274-1 plasmid unnamed, complete sequence 5531-5559 7 0.759
CP020114_15 15.1|4979903|29|CP020114|CRT 4979903-4979931 29 NZ_CP029555 Chromobacterium sp. IIBBL 274-1 plasmid unnamed, complete sequence 64802-64830 7 0.759
CP020114_15 15.3|4980026|29|CP020114|CRT 4980026-4980054 29 NZ_CP039845 Acetobacter pasteurianus strain CICC 22518 plasmid pAP22518-1, complete sequence 282007-282035 8 0.724
CP020114_15 15.3|4980026|29|CP020114|CRT 4980026-4980054 29 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1809632-1809660 8 0.724
CP020114_5 5.5|952803|32|CP020114|PILER-CR,CRISPRCasFinder,CRT 952803-952834 32 NZ_CP014797 Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence 208297-208328 9 0.719
CP020114_5 5.5|952803|32|CP020114|PILER-CR,CRISPRCasFinder,CRT 952803-952834 32 NZ_CP029448 Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence 89771-89802 10 0.688
CP020114_5 5.5|952803|32|CP020114|PILER-CR,CRISPRCasFinder,CRT 952803-952834 32 NZ_CP011641 Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence 25722-25753 10 0.688
CP020114_5 5.3|952663|32|CP020114|PILER-CR,CRISPRCasFinder,CRT 952663-952694 32 NZ_CP015942 Legionella pneumophila strain C9_S plasmid unnamed1, complete sequence 7452-7483 11 0.656

1. spacer 15.3|4980026|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

aggagggggatgatctcaccattaactcg	CRISPR spacer
aggagggggatgatctcaccattaactcg	Protospacer
*****************************

2. spacer 15.3|4980026|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 0, identity: 1.0

aggagggggatgatctcaccattaactcg	CRISPR spacer
aggagggggatgatctcaccattaactcg	Protospacer
*****************************

3. spacer 15.1|4979903|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.966

gggagggggatgctctcaccattaactcg	CRISPR spacer
gggagggggatgatctcaccattaactcg	Protospacer
************ ****************

4. spacer 15.3|4980026|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 1, identity: 0.966

aggagggggatgatctcaccattaactcg	CRISPR spacer
gggagggggatgatctcaccattaactcg	Protospacer
.****************************

5. spacer 15.1|4979903|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.931

gggagggggatgctctcaccattaactcg	CRISPR spacer
aggagggggatgatctcaccattaactcg	Protospacer
.*********** ****************

6. spacer 15.1|4979903|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.931

gggagggggatgctctcaccattaactcg	CRISPR spacer
aggagggggatgatctcaccattaactcg	Protospacer
.*********** ****************

7. spacer 15.1|4979903|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.931

gggagggggatgctctcaccattaactcg	CRISPR spacer
gggagggggatgatctcaccattaacccg	Protospacer
************ *************.**

8. spacer 15.1|4979903|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.931

gggagggggatgctctcaccattaactcg	CRISPR spacer
gggagggggatgatctcaccattaacccg	Protospacer
************ *************.**

9. spacer 15.3|4980026|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.931

aggagggggatgatctcaccattaactcg	CRISPR spacer
gggagggggatgatctcaccattaacccg	Protospacer
.*************************.**

10. spacer 15.3|4980026|29|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 2, identity: 0.931

aggagggggatgatctcaccattaactcg	CRISPR spacer
gggagggggatgatctcaccattaacccg	Protospacer
.*************************.**

11. spacer 15.2|4979966|26|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 4, identity: 0.846

ccgaaggggatcgcgctaaagatata	CRISPR spacer
aagaaggggagcgcgcgaaagatata	Protospacer
  ******** ***** *********

12. spacer 15.2|4979966|26|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 4, identity: 0.846

ccgaaggggatcgcgctaaagatata	CRISPR spacer
aagaaggggagcgcgcgaaagatata	Protospacer
  ******** ***** *********

13. spacer 15.2|4979966|26|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 4, identity: 0.846

ccgaaggggatcgcgctaaagatata	CRISPR spacer
aagaaggggagcgcgcgaaagatata	Protospacer
  ******** ***** *********

14. spacer 15.2|4979966|26|CP020114|CRT matches to NZ_CP020115 (Nodularia spumigena UHCC 0039 plasmid pUHCC0039a, complete sequence) position: , mismatch: 4, identity: 0.846

ccgaaggggatcgcgctaaagatata	CRISPR spacer
aagaaggggagcgcgcgaaagatata	Protospacer
  ******** ***** *********

15. spacer 15.1|4979903|29|CP020114|CRT matches to NZ_CP029555 (Chromobacterium sp. IIBBL 274-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

gggagggggatgctctcaccattaactcg	CRISPR spacer
tggatggtgatgctctcaccattatccat	Protospacer
 *** ** **************** *.  

16. spacer 15.1|4979903|29|CP020114|CRT matches to NZ_CP029555 (Chromobacterium sp. IIBBL 274-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759

gggagggggatgctctcaccattaactcg	CRISPR spacer
tggatggtgatgctctcaccattatccat	Protospacer
 *** ** **************** *.  

17. spacer 15.3|4980026|29|CP020114|CRT matches to NZ_CP039845 (Acetobacter pasteurianus strain CICC 22518 plasmid pAP22518-1, complete sequence) position: , mismatch: 8, identity: 0.724

aggagggggatgatctcaccattaactcg	CRISPR spacer
tagaggggggtgatctcaccataaatgga	Protospacer
 .*******.************ **.  .

18. spacer 15.3|4980026|29|CP020114|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.724

aggagggggatgatctcaccattaactcg	CRISPR spacer
tcgaggcggatgatctcaccattcagcat	Protospacer
  **** **************** * .  

19. spacer 5.5|952803|32|CP020114|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 9, identity: 0.719

ttgctatggcgtttgattttgttccgaaaagc	CRISPR spacer
tgcttatggtgtttgattttgtttcgatgccc	Protospacer
*  .*****.*************.*** .  *

20. spacer 5.5|952803|32|CP020114|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029448 (Serratia marcescens strain CAV1761 plasmid pCAV1761-205, complete sequence) position: , mismatch: 10, identity: 0.688

ttgctatggcgtttgattttgttccgaaaagc	CRISPR spacer
cacctatggcgtttgattatgttctgaggttt	Protospacer
.  *************** *****.**..  .

21. spacer 5.5|952803|32|CP020114|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011641 (Serratia marcescens strain CAV1492 plasmid pCAV1492-199, complete sequence) position: , mismatch: 10, identity: 0.688

ttgctatggcgtttgattttgttccgaaaagc	CRISPR spacer
cacctatggcgtttgattatgttctgaggttt	Protospacer
.  *************** *****.**..  .

22. spacer 5.3|952663|32|CP020114|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015942 (Legionella pneumophila strain C9_S plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656

ccgataagcgaaaaacacgcttaagggtaatc	CRISPR spacer
aaattaagcgaaaaaagcgcttaagggattgt	Protospacer
  . *********** .**********    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage