Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028842 Clostridium botulinum strain DFPST0029 chromosome, complete genome 8 crisprs DEDDh,csa3,DinG,WYL,cas3,cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10,cmr1gr7,cas6,casR 0 11 6 0

Results visualization

1. CP028842
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_2 2305986-2306345 TypeIII III-B
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_3 2312982-2313277 TypeIII III-B
4 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_4 2313557-2313653 TypeIII III-B
1 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_5 2313770-2314067 TypeIII III-B
4 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_6 2314341-2314436 TypeIII III-B
1 spacers
cmr6gr7,cmr5gr11,cmr4gr7,cmr3gr5,cas10

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_7 2327923-2328081 TypeIII III-B
2 spacers
cas6,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_8 2328985-2329214 TypeIII III-B
3 spacers
cas6,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11,cmr6gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028842_9 2331432-2331592 TypeIII III-B
2 spacers
cas6,cmr1gr7,cas10,cmr3gr5,cmr4gr7,cmr5gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028842_2 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT 2306213-2306248 36 NC_012654 Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence 174503-174538 0 1.0
CP028842_2 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT 2306213-2306248 36 NZ_CP006909 Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence 62802-62837 0 1.0
CP028842_2 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT 2306213-2306248 36 NZ_CP031095 Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence 207645-207680 0 1.0
CP028842_4 4.1|2313587|36|CP028842|CRISPRCasFinder 2313587-2313622 36 NZ_CP014152 Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence 149447-149482 0 1.0
CP028842_4 4.1|2313587|36|CP028842|CRISPRCasFinder 2313587-2313622 36 NZ_CP013684 Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence 128281-128316 0 1.0
CP028842_4 4.1|2313587|36|CP028842|CRISPRCasFinder 2313587-2313622 36 NZ_CP013710 Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence 129903-129938 0 1.0
CP028842_4 4.1|2313587|36|CP028842|CRISPRCasFinder 2313587-2313622 36 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 80344-80379 0 1.0
CP028842_4 4.1|2313587|36|CP028842|CRISPRCasFinder 2313587-2313622 36 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 37712-37747 0 1.0
CP028842_2 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT 2306213-2306248 36 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 219276-219311 1 0.972
CP028842_4 4.1|2313587|36|CP028842|CRISPRCasFinder 2313587-2313622 36 NZ_CP013700 Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence 47769-47804 2 0.944
CP028842_8 8.1|2329015|36|CP028842|CRISPRCasFinder 2329015-2329050 36 GU949551 Clostridium phage phiCD6356, complete genome 4906-4941 2 0.944
CP028842_2 2.2|2306082|35|CP028842|CRISPRCasFinder,CRT 2306082-2306116 35 NC_010379 Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence 30926-30960 3 0.914
CP028842_2 2.2|2306082|35|CP028842|CRISPRCasFinder,CRT 2306082-2306116 35 NC_010418 Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence 163878-163912 3 0.914
CP028842_8 8.4|2329015|37|CP028842|CRT 2329015-2329051 37 GU949551 Clostridium phage phiCD6356, complete genome 4906-4942 3 0.919
CP028842_8 8.8|2329150|35|CP028842|PILER-CR 2329150-2329184 35 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 17536-17570 4 0.886
CP028842_8 8.3|2329148|36|CP028842|CRISPRCasFinder 2329148-2329183 36 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 17535-17570 5 0.861
CP028842_8 8.6|2329148|37|CP028842|CRT 2329148-2329184 37 NZ_CP013844 Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence 17535-17571 6 0.838
CP028842_8 8.8|2329150|35|CP028842|PILER-CR 2329150-2329184 35 MN693403 Marine virus AFVG_25M412, complete genome 14464-14498 6 0.829
CP028842_9 9.2|2331528|35|CP028842|CRISPRCasFinder 2331528-2331562 35 MN694042 Marine virus AFVG_250M538, complete genome 50649-50683 7 0.8
CP028842_2 2.3|2306147|36|CP028842|CRISPRCasFinder,CRT 2306147-2306182 36 MT795651 Vibrio phage vB_VnaS-AQKL99, complete genome 5039-5074 8 0.778
CP028842_9 9.2|2331528|35|CP028842|CRISPRCasFinder 2331528-2331562 35 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 1277029-1277063 8 0.771
CP028842_8 8.3|2329148|36|CP028842|CRISPRCasFinder 2329148-2329183 36 MN693403 Marine virus AFVG_25M412, complete genome 14464-14499 10 0.722
CP028842_1 1.2|1901636|40|CP028842|CRISPRCasFinder 1901636-1901675 40 NC_018689 Bacillus thuringiensis MC28 plasmid pMC429, complete sequence 417214-417253 11 0.725
CP028842_8 8.6|2329148|37|CP028842|CRT 2329148-2329184 37 MN693403 Marine virus AFVG_25M412, complete genome 14463-14499 11 0.703

1. spacer 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT matches to NC_012654 (Clostridium botulinum Ba4 str. 657 plasmid pCLJ, complete sequence) position: , mismatch: 0, identity: 1.0

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagataaact	Protospacer
************************************

2. spacer 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT matches to NZ_CP006909 (Clostridium botulinum CDC_1436 plasmid pCBG, complete sequence) position: , mismatch: 0, identity: 1.0

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagataaact	Protospacer
************************************

3. spacer 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT matches to NZ_CP031095 (Clostridium botulinum strain CFSAN034200 plasmid p1_CDC51232, complete sequence) position: , mismatch: 0, identity: 1.0

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagataaact	Protospacer
************************************

4. spacer 4.1|2313587|36|CP028842|CRISPRCasFinder matches to NZ_CP014152 (Clostridium botulinum strain BrDura plasmid pRSJ20_1, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

5. spacer 4.1|2313587|36|CP028842|CRISPRCasFinder matches to NZ_CP013684 (Clostridium botulinum strain AM282 plasmid pRSJ10_1, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

6. spacer 4.1|2313587|36|CP028842|CRISPRCasFinder matches to NZ_CP013710 (Clostridium botulinum strain F634 plasmid pRSJ2_3, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

7. spacer 4.1|2313587|36|CP028842|CRISPRCasFinder matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

8. spacer 4.1|2313587|36|CP028842|CRISPRCasFinder matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 0, identity: 1.0

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaaatgttgtggtataacagaatgtaaata	Protospacer
************************************

9. spacer 2.4|2306213|36|CP028842|CRISPRCasFinder,CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 1, identity: 0.972

atttcatcaaatccgcatcaataaatgagataaact	CRISPR spacer
atttcatcaaatccgcatcaataaatgagattaact	Protospacer
******************************* ****

10. spacer 4.1|2313587|36|CP028842|CRISPRCasFinder matches to NZ_CP013700 (Clostridium botulinum strain AM1195 plasmid pRSJ11_1, complete sequence) position: , mismatch: 2, identity: 0.944

atgttgtaaatgttgtggtataacagaatgtaaata	CRISPR spacer
atgttgtaagtgttgtagtataacagaatgtaaata	Protospacer
*********.******.*******************

11. spacer 8.1|2329015|36|CP028842|CRISPRCasFinder matches to GU949551 (Clostridium phage phiCD6356, complete genome) position: , mismatch: 2, identity: 0.944

aatagagtattcagatgaatataaattcttggaaga	CRISPR spacer
aatagagtattcagatgaatataagttcttagaaga	Protospacer
************************.*****.*****

12. spacer 2.2|2306082|35|CP028842|CRISPRCasFinder,CRT matches to NC_010379 (Clostridium botulinum B1 str. Okra plasmid pCLD, complete sequence) position: , mismatch: 3, identity: 0.914

cttaaatatataggtatagatcaagacgctaaaga	CRISPR spacer
ttgaaatatataggcatagatcaagacgctaaaga	Protospacer
.* ***********.********************

13. spacer 2.2|2306082|35|CP028842|CRISPRCasFinder,CRT matches to NC_010418 (Clostridium botulinum A3 str. Loch Maree plasmid pCLK, complete sequence) position: , mismatch: 3, identity: 0.914

cttaaatatataggtatagatcaagacgctaaaga	CRISPR spacer
ttgaaatatataggcatagatcaagacgctaaaga	Protospacer
.* ***********.********************

14. spacer 8.4|2329015|37|CP028842|CRT matches to GU949551 (Clostridium phage phiCD6356, complete genome) position: , mismatch: 3, identity: 0.919

aatagagtattcagatgaatataaattcttggaagaa	CRISPR spacer
aatagagtattcagatgaatataagttcttagaagat	Protospacer
************************.*****.***** 

15. spacer 8.8|2329150|35|CP028842|PILER-CR matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 4, identity: 0.886

gaccctataacagtttcagaagtagaacaaaatat	CRISPR spacer
aaatctataacagtttcagaagtagaaaaaaatat	Protospacer
.* .*********************** *******

16. spacer 8.3|2329148|36|CP028842|CRISPRCasFinder matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 5, identity: 0.861

cgaccctataacagtttcagaagtagaacaaaatat	CRISPR spacer
taaatctataacagtttcagaagtagaaaaaaatat	Protospacer
..* .*********************** *******

17. spacer 8.6|2329148|37|CP028842|CRT matches to NZ_CP013844 (Clostridium botulinum strain A634 plasmid pRSJ19_2, complete sequence) position: , mismatch: 6, identity: 0.838

cgaccctataacagtttcagaagtagaacaaaatatg	CRISPR spacer
taaatctataacagtttcagaagtagaaaaaaatata	Protospacer
..* .*********************** *******.

18. spacer 8.8|2329150|35|CP028842|PILER-CR matches to MN693403 (Marine virus AFVG_25M412, complete genome) position: , mismatch: 6, identity: 0.829

gacccta-taacagtttcagaagtagaacaaaatat	CRISPR spacer
-acagtactaacagcttcagaagtagcacaaaattt	Protospacer
 **  ** ******.*********** ******* *

19. spacer 9.2|2331528|35|CP028842|CRISPRCasFinder matches to MN694042 (Marine virus AFVG_250M538, complete genome) position: , mismatch: 7, identity: 0.8

tttaatattttttctatatccataggcttaaaatc	CRISPR spacer
tttaatatttcttctttatccatagtgtttataac	Protospacer
**********.**** *********  ** * * *

20. spacer 2.3|2306147|36|CP028842|CRISPRCasFinder,CRT matches to MT795651 (Vibrio phage vB_VnaS-AQKL99, complete genome) position: , mismatch: 8, identity: 0.778

tcttaacctttaattacattatatattataagttca	CRISPR spacer
gcttaacctttaaatacattatacattaccaaccca	Protospacer
 ************ *********.****. *...**

21. spacer 9.2|2331528|35|CP028842|CRISPRCasFinder matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.771

tttaatattttttctatatccataggcttaaaatc--	CRISPR spacer
agtaatattttttctatattcataggc--agcttccg	Protospacer
  *****************.*******  *.  **  

22. spacer 8.3|2329148|36|CP028842|CRISPRCasFinder matches to MN693403 (Marine virus AFVG_25M412, complete genome) position: , mismatch: 10, identity: 0.722

cgaccctataacagtttcagaagtagaacaaaatat	CRISPR spacer
cacagtactaacagcttcagaagtagcacaaaattt	Protospacer
*.   .  ******.*********** ******* *

23. spacer 1.2|1901636|40|CP028842|CRISPRCasFinder matches to NC_018689 (Bacillus thuringiensis MC28 plasmid pMC429, complete sequence) position: , mismatch: 11, identity: 0.725

tatttaaaggatttaaactta---catcatttagatctaagag	CRISPR spacer
tatttaaaggatttaaacttagttcattacataggttatc---	Protospacer
*********************   ***.*. ***.*.      

24. spacer 8.6|2329148|37|CP028842|CRT matches to MN693403 (Marine virus AFVG_25M412, complete genome) position: , mismatch: 11, identity: 0.703

cgaccctataacagtttcagaagtagaacaaaatatg	CRISPR spacer
cacagtactaacagcttcagaagtagcacaaaatttt	Protospacer
*.   .  ******.*********** ******* * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 575757 : 585171 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 910782 : 922501 6 Clostridium_botulinum_D_phage(50.0%) NA NA
DBSCAN-SWA_3 1430643 : 1476071 64 Clostridium_phage(75.0%) terminase,integrase,protease,capsid,head,tail,portal,holin attL 1436255:1436273|attR 1470644:1470662
DBSCAN-SWA_4 1730069 : 1737135 8 uncultured_phage(33.33%) NA NA
DBSCAN-SWA_5 3024872 : 3034356 8 Synechococcus_phage(42.86%) NA NA
DBSCAN-SWA_6 3182792 : 3204692 27 Clostridium_phage(85.71%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage