Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026605 Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence 2 crisprs RT 0 2 0 0
CP026604 Catenovulum sp. CCB-QB4 chromosome, complete genome 0 crisprs RT,cas3,WYL,cas1,cas3f,cas8f,cas5f,cas7f,cas6f,DEDDh,csa3,DinG,PrimPol,cas2,cas4,cas12a,Cas14b_CAS-V-F 0 0 1 0

Results visualization

1. CP026605
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026605_1 194105-194232 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026605_2 195758-195869 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026605_1 1.1|194148|42|CP026605|CRISPRCasFinder 194148-194189 42 NZ_CP026605 Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence 194148-194189 0 1.0
CP026605_2 2.1|195784|60|CP026605|CRISPRCasFinder 195784-195843 60 NZ_CP026605 Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence 195784-195843 0 1.0
CP026605_2 2.1|195784|60|CP026605|CRISPRCasFinder 195784-195843 60 NZ_CP026605 Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence 194017-194076 3 0.95

1. spacer 1.1|194148|42|CP026605|CRISPRCasFinder matches to NZ_CP026605 (Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

ccaacaaggttacgccaagggcaggatttattcctgcaaatg	CRISPR spacer
ccaacaaggttacgccaagggcaggatttattcctgcaaatg	Protospacer
******************************************

2. spacer 2.1|195784|60|CP026605|CRISPRCasFinder matches to NZ_CP026605 (Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

tacagaatggttagataccctgtgttagcggatgtaaaatccgccctacaaggttacgcc	CRISPR spacer
tacagaatggttagataccctgtgttagcggatgtaaaatccgccctacaaggttacgcc	Protospacer
************************************************************

3. spacer 2.1|195784|60|CP026605|CRISPRCasFinder matches to NZ_CP026605 (Catenovulum sp. CCB-QB4 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.95

tacagaatggttagataccctgtgttagcggatgtaaaatccgccctacaaggttacgcc	CRISPR spacer
tgcggaatggttagataccctgtgttagcggatgtaaaatccgccctacaaggttgcgcc	Protospacer
*.*.***************************************************.****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP026604
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1661863 : 1764619 56 Shigella_phage(22.22%) transposase,tRNA,integrase attL 1667693:1667709|attR 1760182:1760198
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage