Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026952 Aeromicrobium sp. 592 chromosome, complete genome 3 crisprs csa3,DEDDh,WYL,cas3,casR,DinG 0 2 0 0

Results visualization

1. CP026952
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026952_1 448066-448172 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026952_2 1081213-1081325 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026952_3 1708014-1708111 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026952_2 2.1|1081252|35|CP026952|CRISPRCasFinder 1081252-1081286 35 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1565315-1565349 7 0.8
CP026952_3 3.1|1708048|30|CP026952|CRISPRCasFinder 1708048-1708077 30 NZ_CP017473 Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence 74326-74355 9 0.7
CP026952_3 3.1|1708048|30|CP026952|CRISPRCasFinder 1708048-1708077 30 KU160664 Arthrobacter phage Salgado, complete genome 43591-43620 9 0.7
CP026952_3 3.1|1708048|30|CP026952|CRISPRCasFinder 1708048-1708077 30 MF140418 Arthrobacter phage LiSara, complete genome 43937-43966 9 0.7
CP026952_3 3.1|1708048|30|CP026952|CRISPRCasFinder 1708048-1708077 30 KU160654 Arthrobacter phage Laroye, complete genome 43775-43804 9 0.7
CP026952_3 3.1|1708048|30|CP026952|CRISPRCasFinder 1708048-1708077 30 MF140434 Arthrobacter phage Wheelbite, complete genome 43743-43772 9 0.7

1. spacer 2.1|1081252|35|CP026952|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.8

cgcccccgcgccgaggggacgcaggatgagggttc	CRISPR spacer
caccaattcgccgaggggaagcaggatgaaggttc	Protospacer
*.**  . *********** *********.*****

2. spacer 3.1|1708048|30|CP026952|CRISPRCasFinder matches to NZ_CP017473 (Enterobacter cloacae strain M12X01451 plasmid pM12X01451, complete sequence) position: , mismatch: 9, identity: 0.7

ttccgtccgccccggcggggaagatgagga	CRISPR spacer
agatgtccgccccgtccgggaagatgacag	Protospacer
   .********** * ********** ..

3. spacer 3.1|1708048|30|CP026952|CRISPRCasFinder matches to KU160664 (Arthrobacter phage Salgado, complete genome) position: , mismatch: 9, identity: 0.7

ttccgtccgccccggcggggaagatgagga	CRISPR spacer
aggtgtctgccccggcggggaggatgacac	Protospacer
   .***.*************.***** . 

4. spacer 3.1|1708048|30|CP026952|CRISPRCasFinder matches to MF140418 (Arthrobacter phage LiSara, complete genome) position: , mismatch: 9, identity: 0.7

ttccgtccgccccggcggggaagatgagga	CRISPR spacer
aggtgtctgccccggcggggaggatgacac	Protospacer
   .***.*************.***** . 

5. spacer 3.1|1708048|30|CP026952|CRISPRCasFinder matches to KU160654 (Arthrobacter phage Laroye, complete genome) position: , mismatch: 9, identity: 0.7

ttccgtccgccccggcggggaagatgagga	CRISPR spacer
aggtgtctgccccggcggggaggatgacac	Protospacer
   .***.*************.***** . 

6. spacer 3.1|1708048|30|CP026952|CRISPRCasFinder matches to MF140434 (Arthrobacter phage Wheelbite, complete genome) position: , mismatch: 9, identity: 0.7

ttccgtccgccccggcggggaagatgagga	CRISPR spacer
aagtgtctgccccggcggggaggatgacac	Protospacer
   .***.*************.***** . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage