Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028960 Methyloceanibacter sp. wino2 chromosome, complete genome 3 crisprs NA 0 1 0 0

Results visualization

1. CP028960
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028960_1 188683-188792 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028960_2 396364-396453 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028960_3 2043225-2043495 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028960_1 1.1|188724|28|CP028960|CRISPRCasFinder 188724-188751 28 NZ_CP032828 Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence 54289-54316 4 0.857
CP028960_1 1.1|188724|28|CP028960|CRISPRCasFinder 188724-188751 28 MT310890 Microbacterium phage Phedro, complete genome 4089-4116 5 0.821
CP028960_1 1.1|188724|28|CP028960|CRISPRCasFinder 188724-188751 28 MT310889 Microbacterium phage Phractured, complete genome 4089-4116 5 0.821
CP028960_1 1.1|188724|28|CP028960|CRISPRCasFinder 188724-188751 28 MT310891 Microbacterium phage Pharky, complete genome 4089-4116 5 0.821
CP028960_1 1.1|188724|28|CP028960|CRISPRCasFinder 188724-188751 28 NZ_CP030127 Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence 850741-850768 7 0.75

1. spacer 1.1|188724|28|CP028960|CRISPRCasFinder matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857 

gatgacgcctggctcagagacgccggcc	CRISPR spacer
gagtacgcctggcacagacacgccggcc	Protospacer
**  ********* **** *********

2. spacer 1.1|188724|28|CP028960|CRISPRCasFinder matches to MT310890 (Microbacterium phage Phedro, complete genome) position: , mismatch: 5, identity: 0.821 

gatgacgcctggctcagagacgccggcc	CRISPR spacer
catgacgcctggatcagggacgccggtg	Protospacer
 *********** ****.********.

3. spacer 1.1|188724|28|CP028960|CRISPRCasFinder matches to MT310889 (Microbacterium phage Phractured, complete genome) position: , mismatch: 5, identity: 0.821 

gatgacgcctggctcagagacgccggcc	CRISPR spacer
catgacgcctggatcagggacgccggtg	Protospacer
 *********** ****.********.

4. spacer 1.1|188724|28|CP028960|CRISPRCasFinder matches to MT310891 (Microbacterium phage Pharky, complete genome) position: , mismatch: 5, identity: 0.821 

gatgacgcctggctcagagacgccggcc	CRISPR spacer
catgacgcctggatcagggacgccggtg	Protospacer
 *********** ****.********.

5. spacer 1.1|188724|28|CP028960|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75 

gatgacgcctggctcagagacgccggcc	CRISPR spacer
cgacacgcctggcgcagtgacgccggca	Protospacer
 .  ********* *** *********

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage