Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025989 Candidatus Fokinia solitaria isolate Rio ETE_ALG 3VII chromosome, complete genome 1 crisprs NA 0 1 2 0

Results visualization

1. CP025989
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025989_2 287757-287855 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025989_4 4.1|476199|28|CP025989|CRISPRCasFinder 476199-476226 28 NC_017060 Rahnella aquatilis HX2 plasmid PRA1, complete sequence 138963-138990 6 0.786
CP025989_4 4.1|476199|28|CP025989|CRISPRCasFinder 476199-476226 28 NC_015062 Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence 142133-142160 6 0.786
CP025989_4 4.1|476199|28|CP025989|CRISPRCasFinder 476199-476226 28 JF270478 Psychrobacter phage Psymv2, complete genome 19699-19726 7 0.75
CP025989_4 4.1|476199|28|CP025989|CRISPRCasFinder 476199-476226 28 NC_013164 Anaerococcus prevotii DSM 20548 plasmid pAPRE01, complete sequence 106218-106245 7 0.75

1. spacer 4.1|476199|28|CP025989|CRISPRCasFinder matches to NC_017060 (Rahnella aquatilis HX2 plasmid PRA1, complete sequence) position: , mismatch: 6, identity: 0.786

gaagcggataaattgcaagaaaagaagc	CRISPR spacer
cagcagcataaatggcaagaaaagaagc	Protospacer
 *.  * ****** **************

2. spacer 4.1|476199|28|CP025989|CRISPRCasFinder matches to NC_015062 (Rahnella sp. Y9602 plasmid pRAHAQ01, complete sequence) position: , mismatch: 6, identity: 0.786

gaagcggataaattgcaagaaaagaagc	CRISPR spacer
cagcagcataaatggcaagaaaagaagc	Protospacer
 *.  * ****** **************

3. spacer 4.1|476199|28|CP025989|CRISPRCasFinder matches to JF270478 (Psychrobacter phage Psymv2, complete genome) position: , mismatch: 7, identity: 0.75

gaagcggataaattgcaagaaaagaagc	CRISPR spacer
gatgctgataaattgcaagaaaaagctg	Protospacer
** ** *****************..   

4. spacer 4.1|476199|28|CP025989|CRISPRCasFinder matches to NC_013164 (Anaerococcus prevotii DSM 20548 plasmid pAPRE01, complete sequence) position: , mismatch: 7, identity: 0.75

gaagcggataaattgcaagaaaagaagc	CRISPR spacer
aagctcgataaattgcaagaaaaaaaga	Protospacer
.*. . *****************.*** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 363995 : 371141 8 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_2 495902 : 505612 9 unidentified_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage