Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027805 Lactobacillus reuteri strain WHH1689 chromosome, complete genome 1 crisprs RT,cas3,DEDDh,cas14j,DinG,cas9,csa3 0 1 17 0

Results visualization

1. CP027805
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027805_1 1183430-1183591 NA
2 spacers
RT,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027805_1 1.2|1183526|36|CP027805|CRISPRCasFinder 1183526-1183561 36 NC_021496 Lactobacillus reuteri I5007 plasmid pLRI02, complete sequence 17882-17917 6 0.833

1. spacer 1.2|1183526|36|CP027805|CRISPRCasFinder matches to NC_021496 (Lactobacillus reuteri I5007 plasmid pLRI02, complete sequence) position: , mismatch: 6, identity: 0.833

ctaaaactgatgatctgcaaacacaaacagcttagg	CRISPR spacer
gttttattgatgatctgcaaacgcaaacagcttagg	Protospacer
 *   *.***************.*************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 16050 : 47974 38 Bacillus_phage(27.27%) protease,transposase NA
DBSCAN-SWA_2 85012 : 123171 38 Paenibacillus_phage(30.0%) tRNA,integrase,transposase attL 96873:96892|attR 105453:105472
DBSCAN-SWA_3 282360 : 321938 36 Pseudomonas_phage(16.67%) tRNA,integrase,transposase attL 277548:277563|attR 330738:330753
DBSCAN-SWA_4 454493 : 499345 47 unidentified_phage(21.43%) integrase,protease,transposase attL 464137:464196|attR 499387:499487
DBSCAN-SWA_5 512702 : 558928 49 Paenibacillus_phage(36.36%) integrase,transposase attL 558540:558599|attR 568052:568172
DBSCAN-SWA_6 668072 : 715426 45 unidentified_phage(20.0%) tRNA,integrase,transposase attL 670969:671028|attR 725712:725811
DBSCAN-SWA_7 739042 : 767090 30 Paenibacillus_phage(36.36%) integrase,protease,transposase attL 738614:738641|attR 769420:769447
DBSCAN-SWA_8 845649 : 895417 48 Staphylococcus_phage(11.76%) tRNA,integrase,transposase attL 861447:861461|attR 880027:880041
DBSCAN-SWA_9 964072 : 1055110 97 Bacillus_phage(14.81%) integrase,holin,transposase attL 1017454:1017477|attR 1055513:1055536
DBSCAN-SWA_10 1072068 : 1128346 53 Bacillus_phage(30.77%) integrase,transposase attL 1119007:1119030|attR 1129589:1129612
DBSCAN-SWA_11 1132325 : 1184616 54 Streptococcus_phage(23.08%) integrase,transposase attL 1140485:1140501|attR 1186142:1186158
DBSCAN-SWA_12 1337235 : 1542939 220 Erysipelothrix_phage(23.29%) tail,integrase,capsid,protease,holin,terminase,tRNA,portal,head,transposase attL 1423086:1423145|attR 1546831:1546844
DBSCAN-SWA_13 1557982 : 1590022 32 Paenibacillus_phage(33.33%) integrase,protease,transposase attL 1562403:1562419|attR 1582168:1582184
DBSCAN-SWA_14 1610037 : 1730916 129 Paenibacillus_phage(24.0%) tRNA,integrase,transposase attL 1635787:1635817|attR 1728693:1728793
DBSCAN-SWA_15 1808560 : 1854751 49 Bacillus_phage(23.08%) tRNA,integrase,transposase attL 1831979:1831995|attR 1861886:1861902
DBSCAN-SWA_16 1858627 : 1960987 114 Streptococcus_phage(25.71%) tRNA,integrase,transposase attL 1850916:1850975|attR 1968865:1969021
DBSCAN-SWA_17 1969242 : 2013694 55 Streptococcus_phage(18.75%) tRNA,integrase,transposase attL 1968766:1968794|attR 2010759:2010787
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage