Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027225 Phytobacter sp. SCO41 chromosome, complete genome 3 crisprs NA 0 2 0 0

Results visualization

1. CP027225
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027225_1 1091198-1091409 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027225_2 1096671-1096755 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027225_3 2314031-2314160 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027225_2 2.1|1096695|37|CP027225|CRISPRCasFinder 1096695-1096731 37 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 4490-4526 6 0.838
CP027225_1 1.1|1091227|32|CP027225|PILER-CR,CRISPRCasFinder,CRT 1091227-1091258 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 112045-112076 9 0.719

1. spacer 2.1|1096695|37|CP027225|CRISPRCasFinder matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 6, identity: 0.838 

aaaccggacgaggaaaaaatcgtagcgcttatcaaca	CRISPR spacer
aagatggacgaggaaaaaatcgtagcgctgattaata	Protospacer
**. .************************ **.**.*

2. spacer 1.1|1091227|32|CP027225|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719 

ccgagccgttcccgcgcttcccggaagtagtt	CRISPR spacer
acgagccgttcccccgcttctcggtggtccgc	Protospacer
 ************ ******.*** .**   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage