Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029004 Trueperella pyogenes strain TP-2849 chromosome, complete genome 1 crisprs WYL,DEDDh,DinG,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3,csa3 0 24 2 0

Results visualization

1. CP029004
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029004_1 854691-857952 TypeI-E I-E
53 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029004_1 1.37|856915|33|CP029004|CRISPRCasFinder,CRT 856915-856947 33 NC_048095 Arthrobacter phage Judy, complete genome 38307-38339 3 0.909
CP029004_1 1.89|856918|33|CP029004|PILER-CR 856918-856950 33 NC_048095 Arthrobacter phage Judy, complete genome 38307-38339 3 0.909
CP029004_1 1.7|855085|33|CP029004|CRISPRCasFinder,CRT 855085-855117 33 FR687252 Pantoea phage LIMElight complete genome 26680-26712 7 0.788
CP029004_1 1.7|855085|33|CP029004|CRISPRCasFinder,CRT 855085-855117 33 NC_019454 Pantoea phage LIMElight, complete genome 26680-26712 7 0.788
CP029004_1 1.19|855817|33|CP029004|CRISPRCasFinder,CRT 855817-855849 33 MT276994 Aeromonas phage AhyVDH1, complete genome 21170-21202 7 0.788
CP029004_1 1.26|856244|33|CP029004|CRISPRCasFinder,CRT 856244-856276 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 1021995-1022027 7 0.788
CP029004_1 1.26|856244|33|CP029004|CRISPRCasFinder,CRT 856244-856276 33 NZ_CP042276 Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence 284282-284314 7 0.788
CP029004_1 1.26|856244|33|CP029004|CRISPRCasFinder,CRT 856244-856276 33 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 138954-138986 7 0.788
CP029004_1 1.28|856366|33|CP029004|CRISPRCasFinder,CRT 856366-856398 33 NZ_CP025075 [Bacillus] caldolyticus strain NEB414 plasmid pBcl1, complete sequence 15045-15077 7 0.788
CP029004_1 1.28|856366|33|CP029004|CRISPRCasFinder,CRT 856366-856398 33 NC_014916 Geobacillus sp. Y412MC52 plasmid pGYMC5201, complete sequence 3412-3444 7 0.788
CP029004_1 1.28|856366|33|CP029004|CRISPRCasFinder,CRT 856366-856398 33 NC_013412 Geobacillus sp. Y412MC61, complete sequence 28231-28263 7 0.788
CP029004_1 1.37|856915|33|CP029004|CRISPRCasFinder,CRT 856915-856947 33 NZ_LN831789 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2 68652-68684 7 0.788
CP029004_1 1.59|855088|33|CP029004|PILER-CR 855088-855120 33 FR687252 Pantoea phage LIMElight complete genome 26680-26712 7 0.788
CP029004_1 1.59|855088|33|CP029004|PILER-CR 855088-855120 33 NC_019454 Pantoea phage LIMElight, complete genome 26680-26712 7 0.788
CP029004_1 1.71|855820|33|CP029004|PILER-CR 855820-855852 33 MT276994 Aeromonas phage AhyVDH1, complete genome 21170-21202 7 0.788
CP029004_1 1.78|856247|33|CP029004|PILER-CR 856247-856279 33 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 1021995-1022027 7 0.788
CP029004_1 1.78|856247|33|CP029004|PILER-CR 856247-856279 33 NZ_CP042276 Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence 284282-284314 7 0.788
CP029004_1 1.78|856247|33|CP029004|PILER-CR 856247-856279 33 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 138954-138986 7 0.788
CP029004_1 1.80|856369|33|CP029004|PILER-CR 856369-856401 33 NZ_CP025075 [Bacillus] caldolyticus strain NEB414 plasmid pBcl1, complete sequence 15045-15077 7 0.788
CP029004_1 1.80|856369|33|CP029004|PILER-CR 856369-856401 33 NC_014916 Geobacillus sp. Y412MC52 plasmid pGYMC5201, complete sequence 3412-3444 7 0.788
CP029004_1 1.80|856369|33|CP029004|PILER-CR 856369-856401 33 NC_013412 Geobacillus sp. Y412MC61, complete sequence 28231-28263 7 0.788
CP029004_1 1.89|856918|33|CP029004|PILER-CR 856918-856950 33 NZ_LN831789 Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2 68652-68684 7 0.788
CP029004_1 1.7|855085|33|CP029004|CRISPRCasFinder,CRT 855085-855117 33 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 5363-5395 8 0.758
CP029004_1 1.11|855329|33|CP029004|CRISPRCasFinder,CRT 855329-855361 33 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 834645-834677 8 0.758
CP029004_1 1.25|856183|33|CP029004|CRISPRCasFinder,CRT 856183-856215 33 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 224892-224924 8 0.758
CP029004_1 1.53|857891|34|CP029004|CRISPRCasFinder,CRT 857891-857924 34 MH617500 Microviridae sp. isolate ctgf627, complete genome 2618-2651 8 0.765
CP029004_1 1.59|855088|33|CP029004|PILER-CR 855088-855120 33 NZ_CP010858 Marinovum algicola DG 898 plasmid pMaD3 5363-5395 8 0.758
CP029004_1 1.63|855332|33|CP029004|PILER-CR 855332-855364 33 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 834645-834677 8 0.758
CP029004_1 1.77|856186|33|CP029004|PILER-CR 856186-856218 33 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 224892-224924 8 0.758
CP029004_1 1.105|857894|34|CP029004|PILER-CR 857894-857927 34 MH617500 Microviridae sp. isolate ctgf627, complete genome 2618-2651 8 0.765
CP029004_1 1.14|855512|33|CP029004|CRISPRCasFinder,CRT 855512-855544 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 74094-74126 9 0.727
CP029004_1 1.19|855817|33|CP029004|CRISPRCasFinder,CRT 855817-855849 33 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 239616-239648 9 0.727
CP029004_1 1.37|856915|33|CP029004|CRISPRCasFinder,CRT 856915-856947 33 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 275013-275045 9 0.727
CP029004_1 1.66|855515|33|CP029004|PILER-CR 855515-855547 33 NZ_CP015739 Shinella sp. HZN7 plasmid pShin-03, complete sequence 74094-74126 9 0.727
CP029004_1 1.71|855820|33|CP029004|PILER-CR 855820-855852 33 NZ_CP030354 Novosphingobium sp. P6W plasmid pP6W1, complete sequence 239616-239648 9 0.727
CP029004_1 1.89|856918|33|CP029004|PILER-CR 856918-856950 33 NC_010510 Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence 275013-275045 9 0.727
CP029004_1 1.14|855512|33|CP029004|CRISPRCasFinder,CRT 855512-855544 33 MN585994 Mycobacterium phage SheaKeira, complete genome 1260-1292 10 0.697
CP029004_1 1.14|855512|33|CP029004|CRISPRCasFinder,CRT 855512-855544 33 NC_048859 Bifidobacterium phage BadAargau2, complete genome 5732-5764 10 0.697
CP029004_1 1.17|855695|33|CP029004|CRISPRCasFinder,CRT 855695-855727 33 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 6270-6302 10 0.697
CP029004_1 1.17|855695|33|CP029004|CRISPRCasFinder,CRT 855695-855727 33 NZ_CP029177 Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence 43647-43679 10 0.697
CP029004_1 1.26|856244|33|CP029004|CRISPRCasFinder,CRT 856244-856276 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1019120-1019152 10 0.697
CP029004_1 1.38|856976|33|CP029004|CRISPRCasFinder,CRT 856976-857008 33 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 81504-81536 10 0.697
CP029004_1 1.38|856976|33|CP029004|CRISPRCasFinder,CRT 856976-857008 33 NC_007412 Trichormus variabilis ATCC 29413 plasmid C, complete sequence 230194-230226 10 0.697
CP029004_1 1.38|856976|33|CP029004|CRISPRCasFinder,CRT 856976-857008 33 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 91551-91583 10 0.697
CP029004_1 1.44|857342|33|CP029004|CRISPRCasFinder,CRT 857342-857374 33 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 4050-4082 10 0.697
CP029004_1 1.66|855515|33|CP029004|PILER-CR 855515-855547 33 MN585994 Mycobacterium phage SheaKeira, complete genome 1260-1292 10 0.697
CP029004_1 1.66|855515|33|CP029004|PILER-CR 855515-855547 33 NC_048859 Bifidobacterium phage BadAargau2, complete genome 5732-5764 10 0.697
CP029004_1 1.69|855698|33|CP029004|PILER-CR 855698-855730 33 NZ_CP016617 Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence 6270-6302 10 0.697
CP029004_1 1.69|855698|33|CP029004|PILER-CR 855698-855730 33 NZ_CP029177 Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence 43647-43679 10 0.697
CP029004_1 1.78|856247|33|CP029004|PILER-CR 856247-856279 33 NZ_CP007130 Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence 1019120-1019152 10 0.697
CP029004_1 1.90|856979|33|CP029004|PILER-CR 856979-857011 33 NC_007410 Trichormus variabilis ATCC 29413 plasmid A, complete sequence 81504-81536 10 0.697
CP029004_1 1.90|856979|33|CP029004|PILER-CR 856979-857011 33 NC_007412 Trichormus variabilis ATCC 29413 plasmid C, complete sequence 230194-230226 10 0.697
CP029004_1 1.90|856979|33|CP029004|PILER-CR 856979-857011 33 NZ_CP047243 Trichormus variabilis 0441 plasmid unnamed1, complete sequence 91551-91583 10 0.697
CP029004_1 1.96|857345|33|CP029004|PILER-CR 857345-857377 33 NZ_CP011481 Hoeflea sp. IMCC20628 plasmid, complete sequence 4050-4082 10 0.697

1. spacer 1.37|856915|33|CP029004|CRISPRCasFinder,CRT matches to NC_048095 (Arthrobacter phage Judy, complete genome) position: , mismatch: 3, identity: 0.909

agagggcgtaggccgcgaacttggtgtacgggg	CRISPR spacer
ggagggcgtaggcgccgaacttggtgtacgggg	Protospacer
.************  ******************

2. spacer 1.89|856918|33|CP029004|PILER-CR matches to NC_048095 (Arthrobacter phage Judy, complete genome) position: , mismatch: 3, identity: 0.909

agagggcgtaggccgcgaacttggtgtacgggg	CRISPR spacer
ggagggcgtaggcgccgaacttggtgtacgggg	Protospacer
.************  ******************

3. spacer 1.7|855085|33|CP029004|CRISPRCasFinder,CRT matches to FR687252 (Pantoea phage LIMElight complete genome) position: , mismatch: 7, identity: 0.788

acgccggtcgcggtaatcgtctgctcgatcccg	CRISPR spacer
tcggcggtcggggtaatcgtctgctctaccgtg	Protospacer
 ** ****** *************** *.* .*

4. spacer 1.7|855085|33|CP029004|CRISPRCasFinder,CRT matches to NC_019454 (Pantoea phage LIMElight, complete genome) position: , mismatch: 7, identity: 0.788

acgccggtcgcggtaatcgtctgctcgatcccg	CRISPR spacer
tcggcggtcggggtaatcgtctgctctaccgtg	Protospacer
 ** ****** *************** *.* .*

5. spacer 1.19|855817|33|CP029004|CRISPRCasFinder,CRT matches to MT276994 (Aeromonas phage AhyVDH1, complete genome) position: , mismatch: 7, identity: 0.788

cgggtcggcgtgagcctgcccggccactaccgg	CRISPR spacer
cagataagcctgagcctgcccggcctctaccgc	Protospacer
*.*.* .** *************** ****** 

6. spacer 1.26|856244|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
tgctgagaacgatatcgagcgcgccgagcgtat	Protospacer
.* ********.** ***************.. 

7. spacer 1.26|856244|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP042276 (Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.788

-cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
ccagtg-ctgcggtgacgagcgccccgagcgcgg	Protospacer
 *.***   .****.******** **********

8. spacer 1.26|856244|33|CP029004|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.788

cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
cgatcaccgcggcaacgaccgcgccgagcgcgg	Protospacer
**.* *  .***.***** **************

9. spacer 1.28|856366|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP025075 ([Bacillus] caldolyticus strain NEB414 plasmid pBcl1, complete sequence) position: , mismatch: 7, identity: 0.788

cctgcgaa--ggcaggggttttcaccctagacgag	CRISPR spacer
--ggccaagtggaaagggttttcaccctagacgaa	Protospacer
   ** **  ** *.*******************.

10. spacer 1.28|856366|33|CP029004|CRISPRCasFinder,CRT matches to NC_014916 (Geobacillus sp. Y412MC52 plasmid pGYMC5201, complete sequence) position: , mismatch: 7, identity: 0.788

cctgcgaa--ggcaggggttttcaccctagacgag	CRISPR spacer
--ggccaagtggaaagggttttcaccctagacgaa	Protospacer
   ** **  ** *.*******************.

11. spacer 1.28|856366|33|CP029004|CRISPRCasFinder,CRT matches to NC_013412 (Geobacillus sp. Y412MC61, complete sequence) position: , mismatch: 7, identity: 0.788

cctgcgaa--ggcaggggttttcaccctagacgag	CRISPR spacer
--ggccaagtggaaagggttttcaccctagacgaa	Protospacer
   ** **  ** *.*******************.

12. spacer 1.37|856915|33|CP029004|CRISPRCasFinder,CRT matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 7, identity: 0.788

agagggcgtaggccgcgaacttggtgtacgggg	CRISPR spacer
agagggcggaggccgcgagcttggcggtccggc	Protospacer
******** *********.*****.*  * ** 

13. spacer 1.59|855088|33|CP029004|PILER-CR matches to FR687252 (Pantoea phage LIMElight complete genome) position: , mismatch: 7, identity: 0.788

acgccggtcgcggtaatcgtctgctcgatcccg	CRISPR spacer
tcggcggtcggggtaatcgtctgctctaccgtg	Protospacer
 ** ****** *************** *.* .*

14. spacer 1.59|855088|33|CP029004|PILER-CR matches to NC_019454 (Pantoea phage LIMElight, complete genome) position: , mismatch: 7, identity: 0.788

acgccggtcgcggtaatcgtctgctcgatcccg	CRISPR spacer
tcggcggtcggggtaatcgtctgctctaccgtg	Protospacer
 ** ****** *************** *.* .*

15. spacer 1.71|855820|33|CP029004|PILER-CR matches to MT276994 (Aeromonas phage AhyVDH1, complete genome) position: , mismatch: 7, identity: 0.788

cgggtcggcgtgagcctgcccggccactaccgg	CRISPR spacer
cagataagcctgagcctgcccggcctctaccgc	Protospacer
*.*.* .** *************** ****** 

16. spacer 1.78|856247|33|CP029004|PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
tgctgagaacgatatcgagcgcgccgagcgtat	Protospacer
.* ********.** ***************.. 

17. spacer 1.78|856247|33|CP029004|PILER-CR matches to NZ_CP042276 (Agrobacterium tumefaciens strain 186 plasmid pAt, complete sequence) position: , mismatch: 7, identity: 0.788

-cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
ccagtg-ctgcggtgacgagcgccccgagcgcgg	Protospacer
 *.***   .****.******** **********

18. spacer 1.78|856247|33|CP029004|PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.788

cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
cgatcaccgcggcaacgaccgcgccgagcgcgg	Protospacer
**.* *  .***.***** **************

19. spacer 1.80|856369|33|CP029004|PILER-CR matches to NZ_CP025075 ([Bacillus] caldolyticus strain NEB414 plasmid pBcl1, complete sequence) position: , mismatch: 7, identity: 0.788

cctgcgaa--ggcaggggttttcaccctagacgag	CRISPR spacer
--ggccaagtggaaagggttttcaccctagacgaa	Protospacer
   ** **  ** *.*******************.

20. spacer 1.80|856369|33|CP029004|PILER-CR matches to NC_014916 (Geobacillus sp. Y412MC52 plasmid pGYMC5201, complete sequence) position: , mismatch: 7, identity: 0.788

cctgcgaa--ggcaggggttttcaccctagacgag	CRISPR spacer
--ggccaagtggaaagggttttcaccctagacgaa	Protospacer
   ** **  ** *.*******************.

21. spacer 1.80|856369|33|CP029004|PILER-CR matches to NC_013412 (Geobacillus sp. Y412MC61, complete sequence) position: , mismatch: 7, identity: 0.788

cctgcgaa--ggcaggggttttcaccctagacgag	CRISPR spacer
--ggccaagtggaaagggttttcaccctagacgaa	Protospacer
   ** **  ** *.*******************.

22. spacer 1.89|856918|33|CP029004|PILER-CR matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 7, identity: 0.788

agagggcgtaggccgcgaacttggtgtacgggg	CRISPR spacer
agagggcggaggccgcgagcttggcggtccggc	Protospacer
******** *********.*****.*  * ** 

23. spacer 1.7|855085|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 8, identity: 0.758

acgccggtcgcggtaatcgtctgctcgatcccg	CRISPR spacer
gcgacccaagcggtcatcgtctgcgcgatcccg	Protospacer
.** *    ***** ********* ********

24. spacer 1.11|855329|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

gtcatccaccaccgtcacgatacccggcatggc	CRISPR spacer
gatgatgaccgccgtcatgatacccggcatggc	Protospacer
* .. . ***.******.***************

25. spacer 1.25|856183|33|CP029004|CRISPRCasFinder,CRT matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.758

gtttccggcgtgtggtcggtgggctgggcgctg	CRISPR spacer
ctacgccgcgtgtgatcggtcggctgggcgccg	Protospacer
 * . * *******.***** **********.*

26. spacer 1.53|857891|34|CP029004|CRISPRCasFinder,CRT matches to MH617500 (Microviridae sp. isolate ctgf627, complete genome) position: , mismatch: 8, identity: 0.765

tgtggcgccagtggaggttggtggtgccacatgt-	CRISPR spacer
ggtggcgccactggaggttggtgatg-gataagcg	Protospacer
 ********* ************.**  *.* *. 

27. spacer 1.59|855088|33|CP029004|PILER-CR matches to NZ_CP010858 (Marinovum algicola DG 898 plasmid pMaD3) position: , mismatch: 8, identity: 0.758

acgccggtcgcggtaatcgtctgctcgatcccg	CRISPR spacer
gcgacccaagcggtcatcgtctgcgcgatcccg	Protospacer
.** *    ***** ********* ********

28. spacer 1.63|855332|33|CP029004|PILER-CR matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758

gtcatccaccaccgtcacgatacccggcatggc	CRISPR spacer
gatgatgaccgccgtcatgatacccggcatggc	Protospacer
* .. . ***.******.***************

29. spacer 1.77|856186|33|CP029004|PILER-CR matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.758

gtttccggcgtgtggtcggtgggctgggcgctg	CRISPR spacer
ctacgccgcgtgtgatcggtcggctgggcgccg	Protospacer
 * . * *******.***** **********.*

30. spacer 1.105|857894|34|CP029004|PILER-CR matches to MH617500 (Microviridae sp. isolate ctgf627, complete genome) position: , mismatch: 8, identity: 0.765

tgtggcgccagtggaggttggtggtgccacatgt-	CRISPR spacer
ggtggcgccactggaggttggtgatg-gataagcg	Protospacer
 ********* ************.**  *.* *. 

31. spacer 1.14|855512|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 9, identity: 0.727

ccggtatcggccttgatctgtgccgtcacacgc	CRISPR spacer
tcggtatcggccctggtctgtgccgtgcttttc	Protospacer
.***********.**.**********  . . *

32. spacer 1.19|855817|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 9, identity: 0.727

cgggtcggcgtgagcctgcccggccactaccgg	CRISPR spacer
atcgtcggcgtgcgcctgaccggccaccgcaag	Protospacer
   ********* ***** ********..* .*

33. spacer 1.37|856915|33|CP029004|CRISPRCasFinder,CRT matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 9, identity: 0.727

agagggcgtaggccgcgaacttggtgtacgggg	CRISPR spacer
cgagggcgaaggccgcgaccttggtgcggtaga	Protospacer
 ******* ********* *******..  .*.

34. spacer 1.66|855515|33|CP029004|PILER-CR matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 9, identity: 0.727

ccggtatcggccttgatctgtgccgtcacacgc	CRISPR spacer
tcggtatcggccctggtctgtgccgtgcttttc	Protospacer
.***********.**.**********  . . *

35. spacer 1.71|855820|33|CP029004|PILER-CR matches to NZ_CP030354 (Novosphingobium sp. P6W plasmid pP6W1, complete sequence) position: , mismatch: 9, identity: 0.727

cgggtcggcgtgagcctgcccggccactaccgg	CRISPR spacer
atcgtcggcgtgcgcctgaccggccaccgcaag	Protospacer
   ********* ***** ********..* .*

36. spacer 1.89|856918|33|CP029004|PILER-CR matches to NC_010510 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD01, complete sequence) position: , mismatch: 9, identity: 0.727

agagggcgtaggccgcgaacttggtgtacgggg	CRISPR spacer
cgagggcgaaggccgcgaccttggtgcggtaga	Protospacer
 ******* ********* *******..  .*.

37. spacer 1.14|855512|33|CP029004|CRISPRCasFinder,CRT matches to MN585994 (Mycobacterium phage SheaKeira, complete genome) position: , mismatch: 10, identity: 0.697

ccggtatcggccttgatctgtgccgtcacacgc	CRISPR spacer
tcggtatcggtcttgatctgtgtcggcgtcgag	Protospacer
.*********.***********.** *..  . 

38. spacer 1.14|855512|33|CP029004|CRISPRCasFinder,CRT matches to NC_048859 (Bifidobacterium phage BadAargau2, complete genome) position: , mismatch: 10, identity: 0.697

ccggtatcggccttgatctgtgccgtcacacgc	CRISPR spacer
gcggtgtcggccttggtctgtgccgacttggct	Protospacer
 ****.*********.********* * ..  .

39. spacer 1.17|855695|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

ctgtcctattcgggtggcgggatcaaggtcgcg	CRISPR spacer
agccgcaattcggatggcgggttcaaggtcgtt	Protospacer
   . * ******.******* *********. 

40. spacer 1.17|855695|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP029177 (Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

ctgtcctattcgggtggcgggatcaaggtcgcg	CRISPR spacer
gatatcaatgcgggtggcgggatcaagggcggt	Protospacer
    .* ** ****************** **  

41. spacer 1.26|856244|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.697

cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
tgccccacacggcgacgagcgcgccgagcgcgc	Protospacer
.* .  . ****..****************** 

42. spacer 1.38|856976|33|CP029004|CRISPRCasFinder,CRT matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 10, identity: 0.697

gtacgaagcctactggcaaggagaagaaccgtg	CRISPR spacer
tgaaacagcctcctggcaaggagaaaaacctca	Protospacer
  * . ***** *************.**** ..

43. spacer 1.38|856976|33|CP029004|CRISPRCasFinder,CRT matches to NC_007412 (Trichormus variabilis ATCC 29413 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

gtacgaagcctactggcaaggagaagaaccgtg	CRISPR spacer
tgaaacagcctcctggcaaggagaaaaacctca	Protospacer
  * . ***** *************.**** ..

44. spacer 1.38|856976|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

gtacgaagcctactggcaaggagaagaaccgtg	CRISPR spacer
tgaaacagcctcctggcaaggagaaaaacctca	Protospacer
  * . ***** *************.**** ..

45. spacer 1.44|857342|33|CP029004|CRISPRCasFinder,CRT matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697

aagccgaccgcgtacagcaccaccttcgagacc	CRISPR spacer
aagccgaccgcgaacagcaccgccaccagcgtt	Protospacer
************ ********.** .*.. ...

46. spacer 1.66|855515|33|CP029004|PILER-CR matches to MN585994 (Mycobacterium phage SheaKeira, complete genome) position: , mismatch: 10, identity: 0.697

ccggtatcggccttgatctgtgccgtcacacgc	CRISPR spacer
tcggtatcggtcttgatctgtgtcggcgtcgag	Protospacer
.*********.***********.** *..  . 

47. spacer 1.66|855515|33|CP029004|PILER-CR matches to NC_048859 (Bifidobacterium phage BadAargau2, complete genome) position: , mismatch: 10, identity: 0.697

ccggtatcggccttgatctgtgccgtcacacgc	CRISPR spacer
gcggtgtcggccttggtctgtgccgacttggct	Protospacer
 ****.*********.********* * ..  .

48. spacer 1.69|855698|33|CP029004|PILER-CR matches to NZ_CP016617 (Microvirga ossetica strain V5/3m plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

ctgtcctattcgggtggcgggatcaaggtcgcg	CRISPR spacer
agccgcaattcggatggcgggttcaaggtcgtt	Protospacer
   . * ******.******* *********. 

49. spacer 1.69|855698|33|CP029004|PILER-CR matches to NZ_CP029177 (Acidibrevibacterium fodinaquatile strain G45-3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

ctgtcctattcgggtggcgggatcaaggtcgcg	CRISPR spacer
gatatcaatgcgggtggcgggatcaagggcggt	Protospacer
    .* ** ****************** **  

50. spacer 1.78|856247|33|CP029004|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.697

cggtgagaacggtaacgagcgcgccgagcgcgg	CRISPR spacer
tgccccacacggcgacgagcgcgccgagcgcgc	Protospacer
.* .  . ****..****************** 

51. spacer 1.90|856979|33|CP029004|PILER-CR matches to NC_007410 (Trichormus variabilis ATCC 29413 plasmid A, complete sequence) position: , mismatch: 10, identity: 0.697

gtacgaagcctactggcaaggagaagaaccgtg	CRISPR spacer
tgaaacagcctcctggcaaggagaaaaacctca	Protospacer
  * . ***** *************.**** ..

52. spacer 1.90|856979|33|CP029004|PILER-CR matches to NC_007412 (Trichormus variabilis ATCC 29413 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.697

gtacgaagcctactggcaaggagaagaaccgtg	CRISPR spacer
tgaaacagcctcctggcaaggagaaaaacctca	Protospacer
  * . ***** *************.**** ..

53. spacer 1.90|856979|33|CP029004|PILER-CR matches to NZ_CP047243 (Trichormus variabilis 0441 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.697

gtacgaagcctactggcaaggagaagaaccgtg	CRISPR spacer
tgaaacagcctcctggcaaggagaaaaacctca	Protospacer
  * . ***** *************.**** ..

54. spacer 1.96|857345|33|CP029004|PILER-CR matches to NZ_CP011481 (Hoeflea sp. IMCC20628 plasmid, complete sequence) position: , mismatch: 10, identity: 0.697

aagccgaccgcgtacagcaccaccttcgagacc	CRISPR spacer
aagccgaccgcgaacagcaccgccaccagcgtt	Protospacer
************ ********.** .*.. ...

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 988964 : 1086050 90 Erysipelothrix_phage(41.67%) protease,holin,tRNA,capsid,transposase,head,tail,portal,terminase NA
DBSCAN-SWA_2 2036235 : 2050141 13 Synechococcus_phage(22.22%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage