Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028111 Escherichia coli O121 str. RM8352 plasmid pRM8352, complete sequence 0 crisprs NA 0 0 1 0
CP028110 Escherichia coli O121 str. RM8352 chromosome, complete genome 5 crisprs DinG,cas3,c2c9_V-U4,csa3,PD-DExK,PrimPol,RT,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh 0 6 19 0

Results visualization

1. CP028111
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7074 : 71900 54 Stx2-converting_phage(38.1%) bacteriocin,transposase,protease,integrase attL 3791:3850|attR 62616:62889

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028110
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028110_1 2956347-2956464 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028110_2 3459741-3460074 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028110_3 3487087-3487360 TypeI-E I-E
4 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028110_4 3835919-3836071 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028110_5 4761216-4761339 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028110_5 5.1|4761259|38|CP028110|CRISPRCasFinder 4761259-4761296 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP028110_2 2.3|3459892|32|CP028110|PILER-CR,CRISPRCasFinder,CRT 3459892-3459923 32 MH389777 Dickeya phage vB_DsoM_JA11, complete genome 116689-116720 6 0.812
CP028110_2 2.3|3459892|32|CP028110|PILER-CR,CRISPRCasFinder,CRT 3459892-3459923 32 MH460462 Dickeya phage vB_DsoM_JA33, complete genome 116679-116710 6 0.812
CP028110_2 2.4|3459953|32|CP028110|PILER-CR,CRISPRCasFinder,CRT 3459953-3459984 32 CP054922 Streptomyces sp. NA03103 plasmid unnamed2, complete sequence 68158-68189 6 0.812
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_AP022602 Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399 61999-62029 7 0.774
CP028110_3 3.4|3487300|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487300-3487330 31 NZ_CP026601 Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence 97057-97087 8 0.742
CP028110_2 2.3|3459892|32|CP028110|PILER-CR,CRISPRCasFinder,CRT 3459892-3459923 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 712830-712861 9 0.719
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP026242 Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence 168728-168758 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP009883 Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence 5480-5510 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP010380 Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence 100872-100902 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP026171 Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence 69668-69698 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP026196 Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence 140212-140242 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_AP021845 Azospira sp. I09 plasmid pAZI09, complete sequence 335649-335679 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 CP009869 Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence 51817-51847 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP042479 Citrobacter freundii strain C50 plasmid pC50_001, complete sequence 136820-136850 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP026208 Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence 50052-50082 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP032179 Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence 65507-65537 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP026391 Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence 6461-6491 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP029142 Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence 256680-256710 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP031135 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence 47915-47945 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP011635 Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence 9471-9501 9 0.71
CP028110_3 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT 3487239-3487269 31 NZ_CP044111 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2 384418-384448 9 0.71
CP028110_4 4.1|3835972|47|CP028110|CRISPRCasFinder 3835972-3836018 47 NZ_CP019906 Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence 2764-2810 10 0.787

1. spacer 5.1|4761259|38|CP028110|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 2.3|3459892|32|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to MH389777 (Dickeya phage vB_DsoM_JA11, complete genome) position: , mismatch: 6, identity: 0.812 

gcgttgatgttcttgcgggtgttgcaaatatt	CRISPR spacer
gcgttgatgtgcttgcaggtgttgcaggtaaa	Protospacer
********** *****.*********..**

3. spacer 2.3|3459892|32|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to MH460462 (Dickeya phage vB_DsoM_JA33, complete genome) position: , mismatch: 6, identity: 0.812 

gcgttgatgttcttgcgggtgttgcaaatatt	CRISPR spacer
gcgttgatgtgcttgcaggtgttgcaggtaaa	Protospacer
********** *****.*********..**

4. spacer 2.4|3459953|32|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

--tttcagcagttcagcgtaacaccgacggtcac	CRISPR spacer
gccttccgc--ttcaccggaacaccgacggtcac	Protospacer
  .*** **  **** ** ***************

5. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 7, identity: 0.774 

ccctgtcgccgttggcggattct---ttcctgta	CRISPR spacer
cccggtcgccggtggcggattctgggtgcat---	Protospacer
*** ******* ***********   * * *

6. spacer 3.4|3487300|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026601 (Clostridiaceae bacterium 14S0207 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742 

tgaaaaaaagggactgggtaacagcgcgtga	CRISPR spacer
tgaaaaaaaggtactggataacattataaga	Protospacer
*********** *****.***** .... **

7. spacer 2.3|3459892|32|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgttgatgttcttgcgggtgttgcaaatatt	CRISPR spacer
tcgttgatgttcttgctggtgctgaactggct	Protospacer
 *************** ****.** *   ..*

8. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026242 (Citrobacter freundii complex sp. CFNIH9 plasmid pCFR-eb27, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

9. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009883 (Pantoea sp. PSNIH1 plasmid pPSP-a3e, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

10. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010380 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-328.905kb, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

11. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026171 (Leclercia sp. LSNIH1 plasmid pLEC-1cb1, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

12. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026196 (Enterobacteriaceae bacterium ENNIH1 plasmid pENT-1f0b, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

13. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

14. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to CP009869 (Pantoea sp. PSNIH2 plasmid pPSP-75c, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

15. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042479 (Citrobacter freundii strain C50 plasmid pC50_001, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

16. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026208 (Escherichia coli strain ECONIH5 plasmid pECO-109b, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

17. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032179 (Citrobacter freundii strain AR_0116 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

18. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026391 (Leclercia sp. LSNIH3 plasmid pLEC-7c0d, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

19. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029142 (Klebsiella michiganensis strain AR375 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

20. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031135 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_1, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

21. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011635 (Klebsiella oxytoca strain CAV1374 plasmid pKPC_CAV1374, complete sequence) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

22. spacer 3.3|3487239|31|CP028110|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044111 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed2) position: , mismatch: 9, identity: 0.71 

ccctgtcgccgttggcggattctttcctgta	CRISPR spacer
cgtcctcgccgtcggcggcttctttcctcgc	Protospacer
* .. *******.***** *********

23. spacer 4.1|3835972|47|CP028110|CRISPRCasFinder matches to NZ_CP019906 (Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.787 

------gtggcgcggtgcaattgccggatgcgatgcttgccgcgtcttatccg	CRISPR spacer
ctagttgaagcac------attgccggatgcgacgcttgccgcgtcttatccg	Protospacer
      * .**.*      **************.*******************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 520968 : 618637 92 Enterobacteria_phage(43.59%) tail,portal,terminase,head,capsid,integrase,transposase,tRNA,protease attL 577763:577809|attR 610111:610157
DBSCAN-SWA_2 957360 : 971780 12 Stx2-converting_phage(30.0%) transposase,tRNA,protease NA
DBSCAN-SWA_3 1056636 : 1164610 132 Escherichia_phage(34.41%) tail,portal,terminase,holin,head,capsid,integrase,lysis,protease attL 1076307:1076325|attR 1122129:1122147
DBSCAN-SWA_4 1285164 : 1375154 120 Stx2-converting_phage(28.75%) tail,portal,holin,head,integrase,transposase,lysis,protease attL 1343298:1343315|attR 1374927:1374944
DBSCAN-SWA_5 1378820 : 1414242 32 Enterobacteria_phage(40.74%) tail,portal,holin,head,capsid,transposase,lysis NA
DBSCAN-SWA_6 1648145 : 1718811 80 Escherichia_phage(46.55%) tail,portal,terminase,holin,integrase,transposase,tRNA,lysis attL 1644831:1644846|attR 1652741:1652756
DBSCAN-SWA_7 1810722 : 1876623 52 Escherichia_phage(27.27%) transposase,protease NA
DBSCAN-SWA_8 1908595 : 1956453 56 Enterobacteria_phage(34.0%) tail,terminase,holin,head,transposase,lysis NA
DBSCAN-SWA_9 2995742 : 3057596 63 Stx2-converting_phage(36.0%) integrase,transposase,tRNA attL 2986557:2986572|attR 3040383:3040398
DBSCAN-SWA_10 3239070 : 3289168 57 Stx2-converting_phage(60.0%) transposase,tRNA,protease NA
DBSCAN-SWA_11 3503685 : 3510825 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_12 3592398 : 3659784 63 Stx2-converting_phage(46.15%) tail,terminase,holin,head,capsid,integrase,transposase,tRNA,lysis attL 3584985:3585001|attR 3608694:3608710
DBSCAN-SWA_13 3914461 : 3980289 83 Escherichia_phage(58.54%) tail,portal,terminase,holin,capsid,bacteriocin,transposase,lysis NA
DBSCAN-SWA_14 4221612 : 4231054 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_15 4322525 : 4330815 7 Klebsiella_phage(14.29%) NA NA
DBSCAN-SWA_16 4457011 : 4511586 72 Enterobacteria_phage(82.93%) tail,portal,terminase,holin,capsid,integrase,plate attL 4476449:4476508|attR 4511693:4511816
DBSCAN-SWA_17 4540920 : 4547546 6 Stx2-converting_phage(83.33%) transposase,tRNA NA
DBSCAN-SWA_18 4834423 : 4976506 163 Escherichia_phage(33.93%) tail,portal,terminase,holin,head,capsid,integrase,transposase,tRNA,lysis,protease attL 4967703:4967717|attR 4980448:4980462
DBSCAN-SWA_19 5325883 : 5363026 50 Enterobacteria_phage(42.86%) tail,terminase,holin,integrase,transposase,lysis attL 5322851:5322864|attR 5332747:5332760

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage