Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028113 Escherichia coli O103 str. RM8385 plasmid pRM8385-1, complete sequence 0 crisprs NA 0 0 1 0
CP028114 Escherichia coli O103 str. RM8385 plasmid pRM8385-2, complete sequence 0 crisprs NA 0 0 0 0
CP028112 Escherichia coli O103 str. RM8385 chromosome, complete genome 6 crisprs DEDDh,DinG,c2c9_V-U4,cas3,PrimPol,csa3,cas2,cas1,cas5,cas7,cse2gr11,cas8e 1 9 22 0

Results visualization

1. CP028113
Click the left colored region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 696 : 65227 48 Stx2-converting_phage(43.75%) transposase,protease NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028112
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028112_1 1589229-1589352 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028112_2 2274945-2275148 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028112_4 2919296-2919440 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028112_5 3616057-3616573 TypeI-E I-E
8 spacers
cas2,cas1,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028112_6 3642275-3642486 Unclear I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028112_7 5454536-5454682 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP028112_2 2.2|2275082|58|CP028112|PILER-CR 2275082-2275139 58 CP028112.1 864837-864894 0 1.0

1. spacer 2.2|2275082|58|CP028112|PILER-CR matches to position: 864837-864894, mismatch: 0, identity: 1.0 

tgggtatatacaggtgggaaagtgggtaattatgtttcaattttgttaaattccccac	CRISPR spacer
tgggtatatacaggtgggaaagtgggtaattatgtttcaattttgttaaattccccac	Protospacer
**********************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028112_3 3.1|2547693|40|CP028112|CRISPRCasFinder 2547693-2547732 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP028112_1 1.1|1589272|38|CP028112|CRISPRCasFinder 1589272-1589309 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP028112_5 5.1|3616086|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616086-3616117 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP028112_6 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT 3642304-3642335 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP028112_5 5.5|3616330|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616330-3616361 32 NZ_CP030355 Novosphingobium sp. P6W plasmid pP6W2, complete sequence 141173-141204 8 0.75
CP028112_6 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT 3642304-3642335 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NC_012852 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence 256608-256639 8 0.75
CP028112_5 5.3|3616208|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616208-3616239 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP028112_5 5.6|3616391|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616391-3616422 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP028112_5 5.6|3616391|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616391-3616422 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719
CP028112_6 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT 3642304-3642335 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP050094 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence 196778-196809 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP050101 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence 151768-151799 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP050106 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence 508685-508716 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP025016 Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence 133778-133809 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NC_008379 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence 180274-180305 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 151061-151092 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP018233 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence 21422-21453 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP025506 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence 499023-499054 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP016293 Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence 106143-106174 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP050111 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence 508869-508900 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP048283 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence 130036-130067 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 172635-172666 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP022668 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence 387130-387161 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP022569 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence 4795-4826 9 0.719
CP028112_6 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR 3642426-3642457 32 NZ_CP050088 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence 158950-158981 9 0.719
CP028112_5 5.5|3616330|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616330-3616361 32 MF417892 Uncultured Caudovirales phage clone 2F_2, partial genome 39822-39853 10 0.688
CP028112_5 5.7|3616452|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616452-3616483 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 903982-904013 10 0.688
CP028112_6 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT 3642304-3642335 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
CP028112_5 5.7|3616452|32|CP028112|PILER-CR,CRISPRCasFinder,CRT 3616452-3616483 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1467285-1467316 11 0.656

1. spacer 3.1|2547693|40|CP028112|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 1.1|1589272|38|CP028112|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 5.1|3616086|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812 

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

4. spacer 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

5. spacer 5.5|3616330|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030355 (Novosphingobium sp. P6W plasmid pP6W2, complete sequence) position: , mismatch: 8, identity: 0.75 

tcttcgcgggtaatcaatgatgattcagtttc	CRISPR spacer
tcttcgcggataatcaaagatgatcgtgaatt	Protospacer
*********.******* ******.  *  *.

6. spacer 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

7. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 8, identity: 0.75 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggtgctgtcgggagcggggaggatgagagaat	Protospacer
. *.******* *** ***********...**

8. spacer 5.3|3616208|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719 

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ .

9. spacer 5.6|3616391|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719 

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .**

10. spacer 5.6|3616391|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719 

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .**

11. spacer 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

12. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

13. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

14. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

15. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

16. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

17. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

18. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

19. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

20. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

21. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

22. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048283 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248c, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

23. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

24. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

25. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

26. spacer 6.3|3642426|32|CP028112|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719 

actactgtcggtagctgggaggatgaggagat	CRISPR spacer
ggcgctgtcgggagcggggaggatgagagaat	Protospacer
. ..******* *** ***********...**

27. spacer 5.5|3616330|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 10, identity: 0.688 

tcttcgcgggtaatcaatgatgattcagtttc	CRISPR spacer
cagttgcaggtaatcaatgatgatgcagccca	Protospacer
.  *.**.**************** ***...

28. spacer 5.7|3616452|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688 

caaaatattacgagcttcgtcaggccatggac	CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgc	Protospacer
.   ..**.*************** **** .*

29. spacer 6.1|3642304|32|CP028112|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******

30. spacer 5.7|3616452|32|CP028112|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656 

caaaatattacgagcttcgtcaggccatggac	CRISPR spacer
tcttgcatcacgagcttcgtcaggacatgcgg	Protospacer
.   ..**.*************** **** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 601746 : 639397 54 Enterobacteria_phage(55.0%) tRNA,head,lysis,integrase,terminase,portal,tail,transposase attL 597550:597565|attR 632964:632979
DBSCAN-SWA_2 773367 : 863204 104 Enterobacteria_phage(41.67%) head,holin,lysis,integrase,terminase,portal,tail,capsid,transposase attL 759053:759071|attR 833304:833322
DBSCAN-SWA_3 941301 : 951229 9 Enterobacteria_phage(62.5%) transposase NA
DBSCAN-SWA_4 1182098 : 1238215 68 Enterobacteria_phage(82.93%) holin,integrase,terminase,capsid,tail,portal,plate attL 1200988:1201047|attR 1238322:1238442
DBSCAN-SWA_5 1322250 : 1412193 110 Escherichia_phage(34.78%) tRNA,head,holin,protease,lysis,integrase,terminase,capsid,tail,transposase attL 1314051:1314065|attR 1355126:1355140
DBSCAN-SWA_6 1423608 : 1464172 57 Shigella_phage(50.0%) head,protease,tail,transposase,plate NA
DBSCAN-SWA_7 1665352 : 1748047 104 Enterobacteria_phage(33.33%) head,holin,protease,tail,lysis,terminase,portal,capsid,transposase NA
DBSCAN-SWA_8 1950501 : 2003638 71 Escherichia_phage(44.26%) tRNA,head,holin,tail,lysis,terminase,portal,capsid,transposase NA
DBSCAN-SWA_9 2080179 : 2156267 85 Enterobacteria_phage(30.19%) head,holin,protease,lysis,integrase,terminase,capsid,tail,transposase attL 2093958:2093985|attR 2156404:2156431
DBSCAN-SWA_10 2260336 : 2276544 22 uncultured_Caudovirales_phage(90.0%) tRNA,head,protease,terminase,portal,tail,capsid NA
DBSCAN-SWA_11 2294222 : 2341012 74 Escherichia_phage(28.3%) head,holin,lysis,integrase,terminase,capsid,tail attL 2325126:2325144|attR 2341337:2341355
DBSCAN-SWA_12 2574700 : 2638694 83 Escherichia_phage(37.1%) head,holin,lysis,integrase,terminase,capsid,tail,transposase attL 2584650:2584709|attR 2637769:2637833
DBSCAN-SWA_13 2866737 : 2917812 72 Enterobacteria_phage(49.25%) holin,protease,lysis,integrase,terminase,portal,tail,transposase attL 2914979:2914994|attR 2922050:2922065
DBSCAN-SWA_14 3146452 : 3171337 25 Enterobacteria_phage(52.38%) head,protease,capsid,tail,transposase NA
DBSCAN-SWA_15 3414913 : 3519911 109 Stx2-converting_phage(32.35%) tRNA,head,holin,lysis,terminase,capsid,tail NA
DBSCAN-SWA_16 3592561 : 3599701 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_17 3751387 : 3759336 9 Stx2-converting_phage(42.86%) transposase,integrase attL 3749344:3749360|attR 3758429:3758445
DBSCAN-SWA_18 4622565 : 4635897 17 Enterobacteria_phage(66.67%) transposase NA
DBSCAN-SWA_19 4887174 : 4989774 110 Escherichia_phage(47.92%) tRNA,head,holin,tail,lysis,integrase,terminase,portal,capsid,transposase,plate attL 4920212:4920258|attR 4951669:4951715
DBSCAN-SWA_20 5121831 : 5186759 84 Enterobacteria_phage(28.99%) tRNA,head,holin,lysis,integrase,terminase,capsid,tail attL 5134011:5134025|attR 5190352:5190366
DBSCAN-SWA_21 5466251 : 5472474 8 Stx2-converting_phage(50.0%) transposase NA
DBSCAN-SWA_22 5496579 : 5503136 9 Stx2-converting_phage(100.0%) transposase NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage