Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029255 Flavobacterium sp. HYN0056 chromosome, complete genome 6 crisprs PD-DExK,csa3,cas3,DEDDh,WYL 0 1 2 0

Results visualization

1. CP029255
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029255_1 82955-83073 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029255_2 803244-803349 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029255_3 1256208-1256280 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029255_4 1816077-1816162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029255_5 2082064-2082174 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029255_6 5402836-5403020 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029255_3 3.1|1256231|27|CP029255|CRISPRCasFinder 1256231-1256257 27 NZ_AP019837 Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p2, complete sequence 5983-6009 6 0.778
CP029255_3 3.1|1256231|27|CP029255|CRISPRCasFinder 1256231-1256257 27 MK448930 Streptococcus phage Javan406, complete genome 33231-33257 6 0.778

1. spacer 3.1|1256231|27|CP029255|CRISPRCasFinder matches to NZ_AP019837 (Leptotrichia wadei strain JMUB3934 plasmid pJMUB3934p2, complete sequence) position: , mismatch: 6, identity: 0.778

gttttggtgcaaattcttcatttttct	CRISPR spacer
tgttaagtgcaaattcttcatttttaa	Protospacer
  ** .*******************  

2. spacer 3.1|1256231|27|CP029255|CRISPRCasFinder matches to MK448930 (Streptococcus phage Javan406, complete genome) position: , mismatch: 6, identity: 0.778

gttttggtgcaaattcttcatttttct	CRISPR spacer
cctttggtgtaaaatcttcatttttta	Protospacer
 .*******.*** ***********. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 355762 : 364789 9 Megavirus(14.29%) NA NA
DBSCAN-SWA_2 768692 : 777529 11 Lactococcus_phage(12.5%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage