Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029482 Pseudomonas sp. 31-12 chromosome, complete genome 2 crisprs PD-DExK,DEDDh,csa3,DinG,cas3,WYL 0 2 4 0

Results visualization

1. CP029482
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029482_1 716904-716999 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029482_4 5108974-5109071 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 141733-141763 2 0.935
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP031958 Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence 18017-18047 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010678 Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence 63170-63200 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_023142 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence 63199-63229 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010789 Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence 63164-63194 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010660 Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence 63160-63190 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010642 Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence 63170-63200 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010773 Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence 63630-63660 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010648 Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence 63596-63626 3 0.903
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010593 Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence 63196-63226 3 0.903
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 141172-141202 4 0.871
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 67871-67901 4 0.871
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 68432-68462 4 0.871
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP021045 Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence 63074-63104 4 0.871
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010685 Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence 62913-62943 4 0.871
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 64562-64592 4 0.871
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 283067-283097 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 530034-530064 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 303415-303445 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 574889-574919 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 31525-31555 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 31610-31640 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1245313-1245343 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_007100 Pseudomonas aeruginosa plasmid Rms149, complete sequence 25607-25637 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 148168-148198 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 380435-380465 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 386441-386471 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP024308 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence 148800-148830 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 571462-571492 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 1553-1583 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 7550-7580 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 636333-636363 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 642330-642360 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 431401-431431 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010744 Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence 31585-31615 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 31609-31639 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 31652-31682 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 976953-976983 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 70922-70952 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 71767-71797 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP051517 Paraburkholderia aromaticivorans strain AR20-38 plasmid unnamed1 13591-13621 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 284716-284746 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 85863-85893 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 91860-91890 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 578436-578466 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029359 Azospirillum sp. CFH 70021 plasmid unnamed4 58110-58140 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_007949 Polaromonas sp. JS666 plasmid 1, complete sequence 25745-25775 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP051182 Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence 63957-63987 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 489517-489547 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 491269-491299 5 0.839
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 1553381-1553411 5 0.839
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 MK359359 Mycobacterium phage Colt, complete genome 90995-91025 5 0.839
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010720 Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence 63658-63688 5 0.839
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 6987-7017 5 0.839
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 6750-6780 5 0.839
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010605 Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence 64682-64712 5 0.839
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP010711 Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence 64682-64712 5 0.839
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 144443-144473 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 28955-28985 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 298418-298448 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 293288-293318 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 303523-303553 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 588223-588253 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 232332-232362 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP045395 Roseovarius sp. THAF27 plasmid pTHAF27_b, complete sequence 37784-37814 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP045395 Roseovarius sp. THAF27 plasmid pTHAF27_b, complete sequence 37676-37706 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 461-491 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 635238-635268 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 23623-23653 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_021289 Burkholderia insecticola plasmid p1, complete sequence 1252452-1252482 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP045413 Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence 40749-40779 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP045413 Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence 40857-40887 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049814 Monaibacterium sp. ALG8 plasmid unnamed3, complete sequence 135138-135168 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 180004-180034 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 613893-613923 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 92955-92985 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 428338-428368 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 582840-582870 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 588654-588684 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 591786-591816 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 596034-596064 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 122765-122795 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 487786-487816 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 24110-24140 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 54991-55021 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1785624-1785654 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 137465-137495 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 107357-107387 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 107918-107948 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 76831-76861 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 36090-36120 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022424 Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence 132279-132309 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 75523-75553 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 76084-76114 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1316100-1316130 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1316985-1317015 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1317870-1317900 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1097576-1097606 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1098461-1098491 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1099346-1099376 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1353978-1354008 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1354863-1354893 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1355748-1355778 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1950659-1950689 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1951544-1951574 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1952429-1952459 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 568252-568282 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 569137-569167 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 570022-570052 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 CP036421 Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence 2284-2314 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 568252-568282 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 569137-569167 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 568240-568270 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 569125-569155 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 570010-570040 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 568260-568290 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 569145-569175 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 570030-570060 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 568237-568267 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 569122-569152 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 570007-570037 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1302003-1302033 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1302003-1302033 6 0.806
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP012399 Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence 615171-615201 6 0.806
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 537442-537472 6 0.806
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP016368 Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence 65245-65275 6 0.806
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 797562-797592 6 0.806
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 144416-144446 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 287471-287501 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 294773-294803 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 293576-293606 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 287918-287948 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032327 Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence 121504-121534 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007798 Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence 102666-102696 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 588331-588361 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 588439-588469 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 273578-273608 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1244983-1245013 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1286562-1286592 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 235337-235367 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1634165-1634195 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1245562-1245592 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_007100 Pseudomonas aeruginosa plasmid Rms149, complete sequence 25364-25394 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 71114-71144 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 356942-356972 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 379394-379424 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 377819-377849 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 356645-356675 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 209501-209531 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 515-545 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 635292-635322 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 599963-599993 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 74248-74278 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 851637-851667 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 73669-73699 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 893309-893339 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 92901-92931 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 1398198-1398228 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 827366-827396 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 827069-827099 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 580125-580155 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 580233-580263 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 583287-583317 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 703937-703967 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 165913-165943 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1063321-1063351 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP019319 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence 41889-41919 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1181212-1181242 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1180915-1180945 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 116243-116273 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022543 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-3, complete sequence 75786-75816 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 20071-20101 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP019585 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence 18984-19014 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 488032-488062 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 489271-489301 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 491023-491053 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 339196-339226 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021821 Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence 164710-164740 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021813 Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence 505633-505663 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 381123-381153 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025584 Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence 77367-77397 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 59076-59106 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 47705-47735 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 25073-25103 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 20071-20101 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 188569-188599 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 189316-189346 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 189397-189427 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 187495-187525 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 188869-188899 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 49805-49835 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 34773-34803 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 718133-718163 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 718025-718055 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 16343-16373 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 36687-36717 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 110630-110660 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 118607-118637 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 228480-228510 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 72811-72841 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 146754-146784 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 289233-289263 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 166482-166512 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 91310-91340 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016588 Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence 181802-181832 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 922102-922132 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 922987-923017 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 923872-923902 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010685 Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence 31666-31696 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025433 Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence 136667-136697 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1590281-1590311 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1591166-1591196 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 1592051-1592081 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 656409-656439 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 657294-657324 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 658179-658209 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 742705-742735 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 743590-743620 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 744475-744505 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 742705-742735 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 743590-743620 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 744475-744505 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 742705-742735 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 743590-743620 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 744475-744505 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 69909-69939 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 261230-261260 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 742709-742739 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 743594-743624 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 744479-744509 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 128126-128156 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 70328-70358 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010648 Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence 31684-31714 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 742705-742735 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 743590-743620 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 744475-744505 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1002290-1002320 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015092 Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence 94271-94301 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1152054-1152084 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1152939-1152969 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1153824-1153854 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 818418-818448 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP030273 Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence 45289-45319 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 CP047033 Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence 38961-38991 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_009040 Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence 122222-122252 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP047039 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence 38946-38976 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 CP036421 Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence 50343-50373 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_010580 Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence 23559-23589 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_010580 Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence 24306-24336 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 763542-763572 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 764427-764457 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 765312-765342 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 763542-763572 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 764427-764457 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 765312-765342 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 120090-120120 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015213 Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence 82759-82789 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 763542-763572 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 764427-764457 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 765312-765342 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 763542-763572 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 764427-764457 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 765312-765342 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 763542-763572 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 764427-764457 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 765312-765342 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP016619 Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence 587366-587396 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1419849-1419879 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1420734-1420764 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 1421619-1421649 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 763544-763574 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 764429-764459 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 765314-765344 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP051470 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence 41409-41439 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_011960 Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence 94504-94534 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015290 Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence 25780-25810 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_011143 Phenylobacterium zucineum HLK1 plasmid, complete sequence 248732-248762 7 0.774
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_048080 Acinetobacter phage vB_AbaM_B09_Aci05, complete genome 19216-19246 7 0.774
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 MT623546 Acinetobacter phage Ab_121, complete genome 13844-13874 7 0.774
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 JF317274 Acinetobacter phage Abp53 head maturation protease, hypothetical protein, phage related protein, tail protein I, tail protein II, tail protein III, and hypothetical proteins genes, complete cds 2326-2356 7 0.774
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_048074 Acinetobacter phage vB_AbaM_B09_Aci01-1, complete genome 18803-18833 7 0.774
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 MH800199 Acinetobacter phage vB_AbaM_B09_Aci02-2, complete genome 18789-18819 7 0.774
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 254497-254527 7 0.774
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_009926 Acaryochloris marina MBIC11017 plasmid pREB1, complete sequence 166998-167028 7 0.774
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 142186-142216 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 283373-283403 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 285170-285200 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 300857-300887 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032327 Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence 120490-120520 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007798 Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence 101652-101682 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022363 Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence 303334-303364 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010626 Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence 62936-62966 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010671 Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence 63021-63051 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 273065-273095 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1286049-1286079 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 235850-235880 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1634678-1634708 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 71141-71171 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 159469-159499 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 356402-356432 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 373898-373928 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 379922-379952 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 234356-234386 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 234464-234494 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 1421489-1421519 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 628773-628803 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 633720-633750 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 1274446-1274476 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010744 Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence 62972-63002 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010622 Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence 62966-62996 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 290121-290151 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 290547-290577 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010702 Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence 63063-63093 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 114234-114264 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1414050-1414080 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 113592-113622 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 1413537-1413567 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 997439-997469 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 297323-297353 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 298067-298097 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 297620-297650 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 298319-298349 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 94473-94503 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 99420-99450 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 826826-826856 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 578328-578358 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 578742-578772 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 580512-580542 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 580539-580569 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 588249-588279 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 591894-591924 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1180672-1180702 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 492505-492535 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_LR594691 Variovorax sp. WDL1 plasmid 3 537250-537280 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025584 Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence 77661-77691 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 59238-59268 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010614 Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence 64606-64636 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 177404-177434 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021045 Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence 63128-63158 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 53803-53833 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP038235 Leisingera sp. NJS201 plasmid unnamed1, complete sequence 88782-88812 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP038235 Leisingera sp. NJS201 plasmid unnamed1, complete sequence 89250-89280 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010678 Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence 63224-63254 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 248058-248088 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1784697-1784727 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1813735-1813765 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1820823-1820853 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_023142 Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence 63253-63283 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010789 Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence 63218-63248 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 7363-7393 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010642 Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence 63224-63254 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010655 Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence 62972-63002 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP014802 Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence 180914-180944 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 171085-171115 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1059497-1059527 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1059200-1059230 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012919 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence 110603-110633 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 41466-41496 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010593 Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence 63250-63280 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 84900-84930 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 73412-73442 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP017947 Bosea sp. Tri-49 plasmid unnamed1, complete sequence 157613-157643 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 225309-225339 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 225930-225960 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 226542-226572 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP031955 Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence 6933-6963 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_018422 Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence 6696-6726 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 214924-214954 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1072878-1072908 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1073175-1073205 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032344 Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence 72838-72868 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 289206-289236 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 291228-291258 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 88082-88112 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 88379-88409 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 88622-88652 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 96410-96440 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049029 Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence 280993-281023 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1318755-1318785 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_008043 Ruegeria sp. TM1040 megaplasmid, complete sequence 9353-9383 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_008043 Ruegeria sp. TM1040 megaplasmid, complete sequence 9110-9140 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 947728-947758 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1100231-1100261 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025433 Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence 26379-26409 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 455681-455711 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029833 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence 455789-455819 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 549645-549675 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 148522-148552 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010605 Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence 64736-64766 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 185980-186010 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 266271-266301 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010732 Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence 64616-64646 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033323 Azospirillum brasilense strain Cd plasmid p5, complete sequence 69882-69912 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP033317 Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence 128099-128129 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010711 Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence 64736-64766 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010748 Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence 62965-62995 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP019311 Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-4, complete sequence 30471-30501 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010739 Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence 63130-63160 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 757809-757839 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1353093-1353123 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 296690-296720 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 743276-743306 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 339714-339744 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 751523-751553 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1949774-1949804 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1409226-1409256 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1095499-1095529 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1002765-1002795 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 2100673-2100703 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 664899-664929 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP030273 Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence 45022-45052 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 CP047033 Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence 38694-38724 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_009040 Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence 121955-121985 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 35281-35311 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP024426 Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence 65896-65926 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP047039 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence 38680-38710 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 CP036421 Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence 1837-1867 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 157610-157640 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 162973-163003 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_010580 Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence 23025-23055 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 5705-5735 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP020445 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence 149257-149287 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010720 Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence 31707-31737 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010720 Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence 63712-63742 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010660 Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence 31596-31626 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010660 Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence 63214-63244 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 902632-902662 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 764343-764373 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 1248771-1248801 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015213 Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence 82492-82522 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010773 Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence 31680-31710 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP010773 Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence 63684-63714 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 19542-19572 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 161784-161814 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 377282-377312 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP051470 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence 41676-41706 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_LN832562 Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence 356722-356752 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP031958 Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence 17963-17993 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP031958 Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence 49996-50026 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015290 Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence 26047-26077 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_AP022333 Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence 183455-183485 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 566669-566699 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 1432648-1432678 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 258275-258305 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP031079 Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence 401807-401837 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP039644 Azospirillum sp. TSA2s plasmid p2, complete sequence 16474-16504 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 610674-610704 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_017959 Tistrella mobilis KA081020-065 plasmid pTM4, complete sequence 10711-10741 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_AP021860 Alteromonas sp. I4 plasmid pAltI4, complete sequence 64378-64408 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 1045687-1045717 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1726448-1726478 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 169582-169612 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NC_009956 Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence 90147-90177 8 0.742
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 1216656-1216686 8 0.742
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032350 Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence 144869-144899 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 284864-284894 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 295655-295685 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_007100 Pseudomonas aeruginosa plasmid Rms149, complete sequence 24953-24983 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 68885-68915 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022365 Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence 71567-71597 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029835 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence 209015-209045 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 629268-629298 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 629754-629784 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 98439-98469 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 98925-98955 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 590913-590943 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1652821-1652851 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032348 Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence 112148-112178 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022305 Thalassococcus sp. S3 plasmid pS3B, complete sequence 50444-50474 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 179435-179465 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 187822-187852 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015094 Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence 36999-37029 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP040763 Paracoccus sp. 2251 plasmid unnamed4, complete sequence 6694-6724 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 175467-175497 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP039640 Azospirillum sp. TSH100 plasmid p1, complete sequence 39458-39488 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022542 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence 85332-85362 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 226515-226545 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP029357 Azospirillum sp. CFH 70021 plasmid unnamed2 226821-226851 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013858 Azospirillum sp. B510 plasmid pAB510d, complete sequence 148630-148660 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 556395-556425 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 168367-168397 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 326434-326464 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP039340 Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence 583334-583364 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025613 Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence 241501-241531 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 98706-98736 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP025431 Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence 100881-100911 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 71676-71706 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_008042 Ruegeria sp. TM1040 plasmid unnamed, complete sequence 4691-4721 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP030273 Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence 79727-79757 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 CP047033 Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence 73413-73443 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_009040 Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence 34022-34052 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP047039 Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence 73381-73411 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP007796 Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence 146281-146311 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 12574-12604 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP016366 Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence 72543-72573 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_022043 Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence 78694-78724 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015213 Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence 117197-117227 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP051470 Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence 6971-7001 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP031116 Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence 167107-167137 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP015290 Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence 115655-115685 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP022567 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence 26793-26823 9 0.71
CP029482_3 3.2|3025870|31|CP029482|CRISPRCasFinder 3025870-3025900 31 NZ_CP034782 Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence 178656-178686 9 0.71
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NC_007100 Pseudomonas aeruginosa plasmid Rms149, complete sequence 29729-29759 10 0.677
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP019319 Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence 17759-17789 10 0.677
CP029482_3 3.1|3025816|31|CP029482|CRISPRCasFinder 3025816-3025846 31 NZ_CP028919 Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence 166387-166417 10 0.677

1. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 2, identity: 0.935

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaacgacacgctgatcggcggcatc	Protospacer
******************* *******.***

2. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

3. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

4. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

5. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

6. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010660 (Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

7. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

8. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010773 (Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

9. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010648 (Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

10. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 3, identity: 0.903

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggtgat	Protospacer
*.************ ************** *

11. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.871

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggcggcatc	Protospacer
**..*************** *******.***

12. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 4, identity: 0.871

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggcggcatc	Protospacer
**..*************** *******.***

13. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 4, identity: 0.871

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcggcatc	Protospacer
** .*************** *******.***

14. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 4, identity: 0.871

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggcgat	Protospacer
*.************ ************.* *

15. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010685 (Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence) position: , mismatch: 4, identity: 0.871

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgactggatcgatggcggcgat	Protospacer
*.************ ************.* *

16. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 4, identity: 0.871

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgatggcaatgactggatcgatggcggtgat	Protospacer
*.*.********** ************** *

17. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcggcagc	Protospacer
** .*************** *******.* *

18. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgttcggcggagcc	Protospacer
 ******************.******* ..*

19. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgttcggcggggcc	Protospacer
 ******************.******* ..*

20. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgttcggcggagcc	Protospacer
 ******************.******* ..*

21. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggtggcaacgacacgctgctgggcggtgac	Protospacer
 *.****************** ******. *

22. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggtggcaacgacacgctgctgggcggtgac	Protospacer
 *.****************** ******. *

23. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgagggcaacgacacgctgatcggcggggcc	Protospacer
*** *************** ******* ..*

24. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgacggcaacgacacactgctcggcggagcc	Protospacer
***.***********.*********** ..*

25. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgttcggcggcaac	Protospacer
** .***************.*******.* *

26. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcgacgacacgctgctgggcggcgac	Protospacer
*******.************* *****.. *

27. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggtgcc	Protospacer
 **.***************.********..*

28. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP024308 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3a, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgaaggcaacgacacgctgatcggcggtggc	Protospacer
.** *************** ********. *

29. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaaggacacgctgctcggcacgctc	Protospacer
********* ***************.   **

30. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcgacgacacgctgctgggcggcgac	Protospacer
*******.************* *****.. *

31. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggtgcc	Protospacer
 **.***************.********..*

32. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcgacgacacgctgctgggcggcgac	Protospacer
*******.************* *****.. *

33. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggtgcc	Protospacer
 **.***************.********..*

34. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaaggacacgctgctcggcacgctc	Protospacer
********* ***************.   **

35. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggtggcaacgacacgctgctgggcggtgac	Protospacer
 *.****************** ******. *

36. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggtggcaacgacacgctgctgggcggtgac	Protospacer
 *.****************** ******. *

37. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggtggcaacgacacgctgctgggcggtgac	Protospacer
 *.****************** ******. *

38. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaaggacacgctgctcggcacgctc	Protospacer
********* ***************.   **

39. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcgacgacacgctgatcggcgggtcc	Protospacer
*******.*********** *******  .*

40. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcgacgacacgctgatcggcggggcc	Protospacer
*******.*********** ******* ..*

41. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP051517 (Paraburkholderia aromaticivorans strain AR20-38 plasmid unnamed1) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgacggcaacgacacgctgctcggcacgctc	Protospacer
***.*********************.   **

42. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaaggacacgctgctcggcacgctc	Protospacer
********* ***************.   **

43. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggtgcc	Protospacer
 **.***************.********..*

44. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcgacgacacgctgctgggcggcgac	Protospacer
*******.************* *****.. *

45. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgctgggcggcagc	Protospacer
** .***************** *****.* *

46. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgttcggcggtgac	Protospacer
** .***************.********. *

47. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_007949 (Polaromonas sp. JS666 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaccctgctcggcggtgcc	Protospacer
**..*********** ************..*

48. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcagcgacacgctgatcggcggcagc	Protospacer
 *******.********** *******.* *

49. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcggtgcc	Protospacer
** .*************** ********..*

50. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 5, identity: 0.839

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcggtgcc	Protospacer
** .*************** ********..*

51. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 5, identity: 0.839

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
caacggcaatgacttgatatatggcggcaat	Protospacer
******************  *******.. *

52. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to MK359359 (Mycobacterium phage Colt, complete genome) position: , mismatch: 5, identity: 0.839

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cttcggcaacggcttgatcgatggcggtgcg	Protospacer
*  ******.*.****************** 

53. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010720 (Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence) position: , mismatch: 5, identity: 0.839

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcgatgactggatcgatggcggcgat	Protospacer
*.*****.****** ************.* *

54. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.839

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcgatgactggatcgatggcggcgat	Protospacer
*.*****.****** ************.* *

55. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 5, identity: 0.839

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcgatgactggatcgatggcggcgat	Protospacer
*.*****.****** ************.* *

56. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 5, identity: 0.839

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcgatgactggatcgatggcggcgat	Protospacer
*.*****.****** ************.* *

57. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 5, identity: 0.839

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcgatgactggatcgatggcggcgat	Protospacer
*.*****.****** ************.* *

58. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggcggtgcg	Protospacer
**..*************** ********.. 

59. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgttcggcggcgcc	Protospacer
** .***************.*******...*

60. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgatcggcggtgac	Protospacer
.* .*************** ********. *

61. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgatcggcggcacc	Protospacer
.* .*************** *******.*.*

62. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgacggcaacgacacgctgttcggcgagggc	Protospacer
***.***************.******. . *

63. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
agatggcaacgacacgctgttcggcggagcg	Protospacer
 ******************.******* .. 

64. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgacggcaacgacacgctgatcggcggctat	Protospacer
***.*************** *******.  .

65. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP045395 (Roseovarius sp. THAF27 plasmid pTHAF27_b, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgaaggcaacgacacgctgatcggcggcgcg	Protospacer
*** *************** *******... 

66. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP045395 (Roseovarius sp. THAF27 plasmid pTHAF27_b, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caacggcaacgacacgctggtcggcagtgcc	Protospacer
*.*.*************** *****.**..*

67. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgagcggcgattac	Protospacer
 ******************  *****.*  *

68. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgagcggcgattac	Protospacer
 ******************  *****.*  *

69. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgctcggcggggcc	Protospacer
 *  *********************** ..*

70. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc-	CRISPR spacer
catcggcaacgacacgctgttcggc-gtaccg	Protospacer
*. .***************.***** ***.* 

71. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP045413 (Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgaaggcaacgacacgctgatcggcggcgcg	Protospacer
*** *************** *******... 

72. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP045413 (Roseovarius sp. THAF8 plasmid pTHAF8_c, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caacggcaacgacacgctggtcggcagtgcc	Protospacer
*.*.*************** *****.**..*

73. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049814 (Monaibacterium sp. ALG8 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgatggcaacgacaccctgcgcggcggtgcg	Protospacer
.************** **** *******.. 

74. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgctcggcggggcc	Protospacer
 *  *********************** ..*

75. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgctcggcggggcc	Protospacer
 *  *********************** ..*

76. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgagcggcgattac	Protospacer
 ******************  *****.*  *

77. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaacgtcacgctgatcggcgatgcg	Protospacer
*********** ******* ******.*.. 

78. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaacgacacgctgctgggcggtgcc	Protospacer
 *..***************** ******..*

79. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgatcggcggcacc	Protospacer
.* .*************** *******.*.*

80. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgacacgctgatcggcggcacc	Protospacer
.*  *************** *******.*.*

81. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctggtgggcggcacc	Protospacer
**..*************** * *****.*.*

82. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggggcc	Protospacer
 **.***************.******* ..*

83. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcggagcc	Protospacer
** .*************** ******* ..*

84. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaccctgctcggcggggcc	Protospacer
**..*********** *********** ..*

85. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgatgatcggcggtcac	Protospacer
** .************ ** ********  *

86. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcagcgacacgctgcacggcggtaac	Protospacer
 * .****.*********** ******** *

87. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgatcggcggcacc	Protospacer
 *  *************** *******.*.*

88. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggcggcgtt	Protospacer
**..*************** *******..*.

89. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcggcctt	Protospacer
** .*************** *******. *.

90. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctggtcggcggggcc	Protospacer
**..*************** ******* ..*

91. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgcaaggcgggctc	Protospacer
**..****************  *****  **

92. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022424 (Vitreoscilla filiformis strain ATCC 15551 plasmid pVF1, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaacgacaccctgttcggcctgaac	Protospacer
*************** ***.*****   * *

93. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcggcctt	Protospacer
** .*************** *******. *.

94. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggcggcgtt	Protospacer
**..*************** *******..*.

95. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

96. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

97. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

98. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

99. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

100. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

101. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

102. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

103. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

104. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

105. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

106. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

107. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

108. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

109. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

110. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to CP036421 (Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc-	CRISPR spacer
ggcgggcaacgacacgctgct-ggggggatcg	Protospacer
 *  ***************** ** ** *** 

111. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

112. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

113. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

114. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

115. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

116. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

117. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

118. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

119. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

120. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

121. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

122. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

123. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.806

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgagacgctggtcggcgggaac	Protospacer
**  ******** ****** ******* * *

124. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 6, identity: 0.806

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
tgccggcaatgacgtgatcgatggcggcgcc	Protospacer
.. ********** *************.**.

125. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 6, identity: 0.806

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
ccacggcaatgacttcatggatggcggcgaa	Protospacer
* ************* ** ********.*  

126. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP016368 (Phaeobacter porticola strain P97 plasmid pP97_d, complete sequence) position: , mismatch: 6, identity: 0.806

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
tgacgggaatgactggatcgatggcggcgat	Protospacer
..**** ******* ************.* *

127. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 6, identity: 0.806

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgacggcaatgacgtgatcaatggcggcggc	Protospacer
*.*********** *****.*******.* .

128. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgatcggcggcggc	Protospacer
 * .*************** *******.. *

129. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctggtcggcggggcg	Protospacer
**..*************** ******* .. 

130. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcgggctg	Protospacer
 * .***************.*******  * 

131. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctggccggcggtgcc	Protospacer
.* .*************** .*******..*

132. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaatgacacgctgatcggcggcgcc	Protospacer
**..*****.********* *******...*

133. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaatgacacgctgatcggcggcctt	Protospacer
**..*****.********* *******. *.

134. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaatgacacgctgatcggcggcctt	Protospacer
**..*****.********* *******. *.

135. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgttcggcgaggcg	Protospacer
 ******************.******. .. 

136. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgatggcaacgacactctgttcggcgaagcg	Protospacer
*************** ***.******. .. 

137. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgagggcaacgacacgctgttcggcgaggag	Protospacer
*** ***************.******. .  

138. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgatcggcaacgcc	Protospacer
 ****************** *****.....*

139. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgagggcaacgacacgctgttcggcgaggag	Protospacer
*** ***************.******. .  

140. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgagggcaacgacacgctgttcggcgaggag	Protospacer
*** ***************.******. .  

141. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgagggcaacgacacgctgttcggcgaggag	Protospacer
*** ***************.******. .  

142. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgatcggcggggcc	Protospacer
.* .*************** ******* ..*

143. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgacaccctgctcggtggcgac	Protospacer
**  *********** ********.**.. *

144. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgatcggcggcggc	Protospacer
 * .*************** *******.. *

145. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggggcg	Protospacer
 **.***************.******* .. 

146. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgatcggcggcgac	Protospacer
 * .*************** *******.. *

147. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcgacgacacgctggtcggcggtgac	Protospacer
 * .***.*********** ********. *

148. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacgcgctgttcggcgggacg	Protospacer
** .*********.*****.******* *. 

149. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gaatggcaacgacacgctgaccggcggagcc	Protospacer
 .***************** .****** ..*

150. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgatcggcggcgac	Protospacer
 * .*************** *******.. *

151. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgatcggcggcgac	Protospacer
 * .*************** *******.. *

152. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ccttggcaacgacacgctggttggcggcggc	Protospacer
*  **************** *.*****.. *

153. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggcaacgacacgctgatcggcaacgcc	Protospacer
 ****************** *****.....*

154. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgagggcaacgacacgctgttcggcgaggag	Protospacer
*** ***************.******. .  

155. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgatcggcggggcc	Protospacer
.* .*************** ******* ..*

156. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacaccctgatcggcggtggc	Protospacer
 *  *********** *** ********. *

157. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgatcggcggcgac	Protospacer
 * .*************** *******.. *

158. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

159. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggggcg	Protospacer
 **.***************.******* .. 

160. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacgcgctgttcggcgggacg	Protospacer
** .*********.*****.******* *. 

161. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaccggcaacgacacgctgctgggcggcagc	Protospacer
 . .***************** *****.* *

162. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagcggcaacgacacgctgctgggcggcgac	Protospacer
*...***************** *****.. *

163. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaccctgatcggcgggacg	Protospacer
**..*********** *** ******* *. 

164. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

165. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

166. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

167. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgcgcggcgggtcg	Protospacer
 **.**************** ******  . 

168. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcggggcg	Protospacer
 **.***************.******* .. 

169. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggttggcaacgacgcgctgttcggcggcacg	Protospacer
 * **********.*****.*******.*. 

170. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgtccggcggcgac	Protospacer
** .***************..******.. *

171. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022543 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-3, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
agatggcaacgacacgctgctgggtggcgat	Protospacer
 ******************** **.**.. .

172. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

173. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

174. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaatgacacgctgatcggcggtgcc	Protospacer
*. .*****.********* ********..*

175. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaatgacacgctggtcggcggtgcc	Protospacer
*. .*****.********* ********..*

176. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaatgacacgctggtcggcggtgcc	Protospacer
*. .*****.********* ********..*

177. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

178. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

179. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

180. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

181. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025584 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caatggcaacgacacgctgatcggcgccgat	Protospacer
*.***************** ****** .. .

182. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ttttggcaacgatacgctgttcggcggcaac	Protospacer
.  *********.******.*******.* *

183. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgacggcaacgacacgctgctgggctatcgc	Protospacer
.**.***************** *** .*  *

184. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgaacggcggcggc	Protospacer
**..***************  ******.. *

185. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacaggctgatcggcggcgac	Protospacer
**..********** **** *******.. *

186. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
agcgggcaacgacacgctggtcggcggcaat	Protospacer
 *  *************** *******.* .

187. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagtggcaacgacacgctgcgcggcgacggc	Protospacer
*..***************** *****... *

188. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctggtcggcggagct	Protospacer
**..*************** ******* ...

189. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagcggcaacgacacgctgaccggcggcctc	Protospacer
*...*************** .******. **

190. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctggtcggtgggctc	Protospacer
 *  *************** ****.**  **

191. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctggggcaacgacacgctgatcggcggcgcc	Protospacer
* . *************** *******...*

192. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcagcgacacgctgctcggcgatggc	Protospacer
 *  ****.*****************.*. *

193. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
catcggcaacgacacgctggtcggcggcggc	Protospacer
*. .*************** *******.. *

194. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagcggcaacgacacgctgatcggcgacaac	Protospacer
*...*************** ******..* *

195. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgacggcaacgatacgctgctcggcctttca	Protospacer
***.********.************  * . 

196. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgttcggtggtgaa	Protospacer
** .***************.****.***.  

197. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggtggtgcg	Protospacer
**..*************** ****.***.. 

198. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgacacgctgcgcggaggcggc	Protospacer
**  **************** *** **.. *

199. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgatacgctgatcggcggcgac	Protospacer
**  ********.****** *******.. *

200. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggtggtgcg	Protospacer
**..*************** ****.***.. 

201. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgttcggtggtgaa	Protospacer
** .***************.****.***.  

202. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacagcctgctcggcggtctg	Protospacer
*. .**********  ************ * 

203. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgctggcaacgacacggtgctgggcggttat	Protospacer
.* ************* **** ******  .

204. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgctgggcggggat	Protospacer
** .***************** ***** . .

205. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctggtcggcggctat	Protospacer
** .*************** *******.  .

206. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

207. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

208. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

209. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010685 (Phaeobacter piscinae strain P14 plasmid pP14_d, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaatgacacgctgctgggcggtgac	Protospacer
 *..*****.*********** ******. *

210. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025433 (Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgctggtaacgacacgctgcgcggcggggcc	Protospacer
.* ***.************* ****** ..*

211. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

212. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

213. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

214. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

215. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

216. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

217. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

218. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

219. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

220. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

221. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

222. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

223. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

224. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

225. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

226. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggtggtgcg	Protospacer
**..*************** ****.***.. 

227. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgttcggtggtgaa	Protospacer
** .***************.****.***.  

228. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

229. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

230. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

231. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggtggtgcg	Protospacer
**..*************** ****.***.. 

232. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtcggcaacgacacgctgttcggtggtgaa	Protospacer
** .***************.****.***.  

233. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010648 (Phaeobacter piscinae strain P36 plasmid pP36_e, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaatgacacgctgctgggcggtgac	Protospacer
 *..*****.*********** ******. *

234. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

235. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

236. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

237. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cactggcaacgacacgctgaccggcggcggc	Protospacer
*. **************** .******.. *

238. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015092 (Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctatgccaacgacacgctgatcggcgcgctg	Protospacer
* *** ************* ******   * 

239. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

240. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

241. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

242. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcaggcaatgacacgctgcgcggcggagcc	Protospacer
**  *****.********** ****** ..*

243. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

244. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

245. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

246. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

247. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to CP036421 (Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgagcggcggcggc	Protospacer
**..***************  ******.. *

248. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_010580 (Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cctcggcaatgacacgctgatcggcgggagc	Protospacer
*  .*****.********* ******* * *

249. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_010580 (Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cctcggcaatgacacgctgatcggcgggacc	Protospacer
*  .*****.********* ******* *.*

250. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

251. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

252. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

253. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

254. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

255. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

256. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctggttggcggcaag	Protospacer
** .*************** *.*****.*  

257. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

258. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

259. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

260. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

261. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

262. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

263. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

264. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

265. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

266. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

267. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
catcggcaacgacacgatcctcggcggcagc	Protospacer
*. .************ * ********.* *

268. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

269. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

270. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

271. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

272. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaac	Protospacer
.*  ******** ****** ******* * *

273. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgtgggcaacgagacgctggtcggcgggaat	Protospacer
**  ******** ****** ******* * .

274. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

275. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

276. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgagcggcggcggc	Protospacer
** .***************  ******.. *

277. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 7, identity: 0.774

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cctgggcaacgacaccctggtcggcgggctc	Protospacer
*   *********** *** *******  **

278. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_048080 (Acinetobacter phage vB_AbaM_B09_Aci05, complete genome) position: , mismatch: 7, identity: 0.774

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
acaaagcaatgacatgatcgatggtggtgca	Protospacer
  * .******** **********.***** 

279. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to MT623546 (Acinetobacter phage Ab_121, complete genome) position: , mismatch: 7, identity: 0.774

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
acaaagcaatgacatgatcgatggtggtgca	Protospacer
  * .******** **********.***** 

280. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to JF317274 (Acinetobacter phage Abp53 head maturation protease, hypothetical protein, phage related protein, tail protein I, tail protein II, tail protein III, and hypothetical proteins genes, complete cds) position: , mismatch: 7, identity: 0.774

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
acaaagcaacgacatgatcgatggcggtgca	Protospacer
  * .****.*** **************** 

281. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_048074 (Acinetobacter phage vB_AbaM_B09_Aci01-1, complete genome) position: , mismatch: 7, identity: 0.774

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
acaaagcaatgacatgatcgatggtggtgca	Protospacer
  * .******** **********.***** 

282. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to MH800199 (Acinetobacter phage vB_AbaM_B09_Aci02-2, complete genome) position: , mismatch: 7, identity: 0.774

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
acaaagcaatgacatgatcgatggtggtgca	Protospacer
  * .******** **********.***** 

283. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 7, identity: 0.774

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cggcggcaatgacgtgatcgacggcgacgcc	Protospacer
*..********** *******.****..**.

284. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_009926 (Acaryochloris marina MBIC11017 plasmid pREB1, complete sequence) position: , mismatch: 7, identity: 0.774

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
catcggcaatgacttgatcggtgtccctgaa	Protospacer
** *****************.** *  **  

285. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacacgctgatcggcgattgg	Protospacer
*. .*************** ******.*   

286. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tctcggcagcgacacgctgatcggcggtgcc	Protospacer
.  .****.********** ********..*

287. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tctcggcagcgacacgctgatcggcggtgcc	Protospacer
.  .****.********** ********..*

288. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacaccctgctgggcggcggc	Protospacer
 * .*********** ***** *****.. *

289. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcgactgg	Protospacer
** .*************** ******..   

290. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgacacgctgatcggcgactgg	Protospacer
** .*************** ******..   

291. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgttcggcgaggac	Protospacer
 *  ***************.******. . *

292. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010626 (Phaeobacter inhibens strain P51 plasmid pP51_c, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

293. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010671 (Phaeobacter inhibens strain P57 plasmid pP57_c, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

294. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

295. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

296. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

297. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

298. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgatcggtggcgcg	Protospacer
**..*************** ****.**... 

299. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcgacgacacgctgatcggcggggcc	Protospacer
 * .***.*********** ******* ..*

300. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

301. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcagcgacacgctgatcggcggggcc	Protospacer
*  .****.********** ******* ..*

302. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgtcggcaacgacacgctgtccggcggcgac	Protospacer
.* .***************..******.. *

303. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctggtcggcgacaat	Protospacer
 *  *************** ******..* .

304. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gcttggcgacgacacgctggtcggcggcggc	Protospacer
   ****.*********** *******.. *

305. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gcgcggcaacgtcacgctgctcggcgatgcc	Protospacer
  ..******* **************.*..*

306. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacacgctgaccggcggggcc	Protospacer
*. .*************** .****** ..*

307. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcgacgacacgctggtcggcggggac	Protospacer
 * .***.*********** ******* . *

308. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gagcggcaacgtcacgctgctcggcgatgcc	Protospacer
 ...******* **************.*..*

309. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010744 (Phaeobacter inhibens strain P59 plasmid pP59_c, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

310. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010622 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

311. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

312. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

313. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

314. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcgaggag	Protospacer
 **.***************.******. .  

315. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggacggcaacgacacgctgttcggcgaggag	Protospacer
 **.***************.******. .  

316. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

317. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

318. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
catcggcaacgacacgctgttcggcgtgccc	Protospacer
*. .***************.******   .*

319. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

320. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

321. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgacgcgctgttcggcgggacg	Protospacer
 * .*********.*****.******* *. 

322. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgacgcgctgttcggcgggacg	Protospacer
 * .*********.*****.******* *. 

323. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcgacgacacgctggtcggcggggac	Protospacer
 * .***.*********** ******* . *

324. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacacgctgaccggcggggcc	Protospacer
*. .*************** .****** ..*

325. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

326. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgcagggcggcgac	Protospacer
 * .****************  *****.. *

327. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ttacggcagcgacacgctgatcggcggggcc	Protospacer
. *.****.********** ******* ..*

328. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctggacggcggcctg	Protospacer
 * .***************  ******. * 

329. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cctgggcagcgacacgctgatcggcggcgcc	Protospacer
*   ****.********** *******...*

330. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
catcggcaacgacacgctggacggcggcgcc	Protospacer
*. .***************  ******...*

331. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcgacgacacgctgatcggcggggcc	Protospacer
.* .***.*********** ******* ..*

332. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

333. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcaacgatacgctgatcggcggagcg	Protospacer
** .********.****** ******* .. 

334. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_LR594691 (Variovorax sp. WDL1 plasmid 3) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacatcctgctcggcggcgcg	Protospacer
**..**********. ***********... 

335. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025584 (Paracoccus jeotgali strain CBA4604 plasmid pCBA4604-01, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gcgcggcaatgacacgctgctcggcggcgcc	Protospacer
  ..*****.*****************...*

336. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgacacgctgggcggcggcgcg	Protospacer
**  ***************  ******... 

337. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010614 (Phaeobacter inhibens strain P92 plasmid pP92_d, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

338. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
agcgggcaacgacacgctgaccggcggaacg	Protospacer
 *  *************** .****** *. 

339. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021045 (Phaeobacter gallaeciensis strain P129 plasmid pP129_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

340. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaacgacacgctggacggcggcgac	Protospacer
 *..***************  ******.. *

341. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tggcggcaatgacacgctgatcggcggcggc	Protospacer
.*..*****.********* *******.. *

342. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP038235 (Leisingera sp. NJS201 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tggcggcaatgacacgctgatcggcggcggc	Protospacer
.*..*****.********* *******.. *

343. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010678 (Phaeobacter gallaeciensis strain P75 plasmid pP75_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

344. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gaacggcaacgacatcctgctcggcggttcg	Protospacer
 .*.**********. ************ . 

345. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctccacggcggcaat	Protospacer
 * .************** * ******.* .

346. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
taatggcaacgacaggctgatcggcagagcc	Protospacer
..************ **** *****.* ..*

347. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
taatggcaacgacaggctgatcggcagagcc	Protospacer
..************ **** *****.* ..*

348. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_023142 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_F69, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

349. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010789 (Phaeobacter gallaeciensis strain P63 plasmid pP63_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

350. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgcgggcaacgacaccctgatcggcggcgat	Protospacer
**  *********** *** *******.. .

351. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010642 (Phaeobacter gallaeciensis strain P73 plasmid pP73_f, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

352. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010655 (Phaeobacter inhibens strain P54 plasmid pP54_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

353. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
catgggcaacgacacgctgaacggcggcgcc	Protospacer
*.  ***************  ******...*

354. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

355. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

356. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgacgcgctgttcggcgggacg	Protospacer
 * .*********.*****.******* *. 

357. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012919 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgaacggcggcggc	Protospacer
 * .***************  ******.. *

358. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cctgggcgacgacacgctggtcggcggcggc	Protospacer
*   ***.*********** *******.. *

359. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010593 (Phaeobacter gallaeciensis strain P11 plasmid pP11_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

360. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgcgcggcgaggcc	Protospacer
 *  **************** *****. ..*

361. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
agctggcaacgacactctggtcggcggcgaa	Protospacer
 * ************ *** *******..  

362. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcatcgacacgctgctcggcggagca	Protospacer
*  .**** ****************** .. 

363. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
attgggcaacgacacgctgatcggcggagcc	Protospacer
    *************** ******* ..*

364. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
attgggcaacgacacgctgatcggcggagcc	Protospacer
    *************** ******* ..*

365. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgacacgctgaccggcggattg	Protospacer
.*  *************** .******  * 

366. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP031955 (Phaeobacter inhibens strain 2.10 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

367. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_018422 (Phaeobacter inhibens 2.10 plasmid pPGA2_71, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

368. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

369. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgttcggcggggcg	Protospacer
 * .***************.******* .. 

370. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgacgcgctgttcggcgggacg	Protospacer
 * .*********.*****.******* *. 

371. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032344 (Azospirillum brasilense strain MTCC4038 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgaacggcggcggc	Protospacer
 * .***************  ******.. *

372. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tctgggcaacgacacgctggtcggcggcggc	Protospacer
.   *************** *******.. *

373. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caacggcagcgacacgctgatcggcggctat	Protospacer
*.*.****.********** *******.  .

374. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgttcggcggggcg	Protospacer
 *  ***************.******* .. 

375. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgacgcgctgttcggcgggacg	Protospacer
 * .*********.*****.******* *. 

376. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgccacgctggtcggcggcgac	Protospacer
 * .******* ******* *******.. *

377. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagcggcgacgacacgctgctcggtggcaat	Protospacer
*...***.****************.**.* .

378. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049029 (Fluviibacterium aquatile strain SC52 plasmid pSC52_1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aggcggcaacgatacgctgcgcggcggtgaa	Protospacer
 *..********.******* *******.  

379. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaat	Protospacer
.*  ******** ****** ******* * .

380. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ccttggcaacgatacgctgctcggtggcgag	Protospacer
*  *********.***********.**..  

381. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_008043 (Ruegeria sp. TM1040 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gcaaggcaacgatacgctgctgggcgggctt	Protospacer
  * ********.******** *****  *.

382. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

383. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaat	Protospacer
.*  ******** ****** ******* * .

384. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025433 (Paracoccus zhejiangensis strain J6 plasmid pPZ03, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cgccggcatcgacacgctgcgcggcggggct	Protospacer
** .**** *********** ****** ...

385. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctggtcggcgacaat	Protospacer
 *  *************** ******..* .

386. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gcttggcgacgacacgctggtcggcggcggc	Protospacer
   ****.*********** *******.. *

387. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

388. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagcggcaacgacacgctgatcggcgacaat	Protospacer
*...*************** ******..* .

389. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010605 (Phaeobacter inhibens strain P83 plasmid pP83_f, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

390. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

391. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

392. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010732 (Phaeobacter inhibens strain P88 plasmid pP88_g, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

393. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgaacggcggcggc	Protospacer
 * .***************  ******.. *

394. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgaacggcggcggc	Protospacer
 * .***************  ******.. *

395. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010711 (Phaeobacter inhibens strain P66 plasmid pP66_f, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

396. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010748 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_c, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

397. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP019311 (Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

398. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010739 (Phaeobacter inhibens strain P72 plasmid pP72_d, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

399. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

400. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaat	Protospacer
.*  ******** ****** ******* * .

401. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaatgacacgctgatcggcggcgac	Protospacer
 * .*****.********* *******.. *

402. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

403. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

404. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

405. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgagacgctggtcggcgggaat	Protospacer
.*  ******** ****** ******* * .

406. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

407. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

408. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

409. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gaacggcaacgacatcctgctcggcggttcg	Protospacer
 .*.**********. ************ . 

410. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

411. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgaacggcggcggc	Protospacer
.* .***************  ******.. *

412. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgaacggcggcggc	Protospacer
.* .***************  ******.. *

413. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgaacggcggcggc	Protospacer
.* .***************  ******.. *

414. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcaacgatacgctgatcggcggggcc	Protospacer
*  .********.****** ******* ..*

415. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP024426 (Paracoccus yeei strain TT13 plasmid pTT13-4, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgcatggcgggcgc	Protospacer
 *  **************** .*****   *

416. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgaacggcggcggc	Protospacer
.* .***************  ******.. *

417. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to CP036421 (Rhodobacter sphaeroides strain HJ plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cggcggcaacgacacgctgcgcgggggcggt	Protospacer
**..**************** *** **.. .

418. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgacacgctgaccggcggggcc	Protospacer
 * .*************** .****** ..*

419. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggtcggcaacgacacgctgaccggcggggcc	Protospacer
 * .*************** .****** ..*

420. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_010580 (Beijerinckia indica subsp. indica ATCC 9039 plasmid pBIND01, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cctcgggaacgacacgctgatcggcggggcc	Protospacer
*  .** ************ ******* ..*

421. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgcatggcgggcgc	Protospacer
 *  **************** .*****   *

422. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP020445 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcaacgatacgctgatcggcggggcc	Protospacer
*  .********.****** ******* ..*

423. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010720 (Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaatgacacgctgctgggcggcgac	Protospacer
 *..*****.*********** *****.. *

424. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010720 (Phaeobacter piscinae strain P18 plasmid pP18_e, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

425. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010660 (Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaatgacacgctgctgggcggcgac	Protospacer
 *..*****.*********** *****.. *

426. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010660 (Phaeobacter piscinae strain P71 plasmid pP71_d, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

427. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

428. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagaggcaacgacgtgctgctcggcggcgcc	Protospacer
*.. *********..************...*

429. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aggcggcaacgacacgctcatcggcggcgcc	Protospacer
 *..**************  *******...*

430. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgaacggcggcggc	Protospacer
.* .***************  ******.. *

431. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010773 (Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaatgacacgctgctgggcggcgac	Protospacer
 *..*****.*********** *****.. *

432. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP010773 (Phaeobacter piscinae strain P13 plasmid pP13_f, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

433. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgcatggcgggcgc	Protospacer
 *  **************** .*****   *

434. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcaacgatacgctgatcggcggggcc	Protospacer
*  .********.****** ******* ..*

435. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacatgctgatcggcggcgac	Protospacer
*. .**********.**** *******.. *

436. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgaacggcggcggc	Protospacer
.* .***************  ******.. *

437. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ccacggcaacgacacgctgtacggcggcgag	Protospacer
* *.***************. ******..  

438. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aaacggcaatgactcgctgctcggcggcaag	Protospacer
 .*.*****.*** *************.*  

439. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP031958 (Phaeobacter sp. LSS9 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaatgacacgctgctgggcggcgac	Protospacer
 *..*****.*********** *****.. *

440. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaacgacacgctgaacggcggcggc	Protospacer
.* .***************  ******.. *

441. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cctcggcgacgacacgctgatcggcggacgc	Protospacer
*  .***.*********** *******   *

442. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacaccctgatcggcgggctg	Protospacer
 * .*********** *** *******  * 

443. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
aggcggcaacgacacgctcatcggcggcgcc	Protospacer
 *..**************  *******...*

444. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcaacgatacgctgatcggcggggcc	Protospacer
*  .********.****** ******* ..*

445. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgcatggcgggcgc	Protospacer
 *  **************** .*****   *

446. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP039644 (Azospirillum sp. TSA2s plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.742

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caacggcaccgacacgctgatcggcggctat	Protospacer
*.*.**** ********** *******.  .

447. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
ggctggcaatgacttcatcgatggcggtctc	Protospacer
 . .*********** ************ ..

448. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_017959 (Tistrella mobilis KA081020-065 plasmid pTM4, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
tggcggcgatgacctgatcgatggcggcggc	Protospacer
...****.*****.*************.* .

449. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_AP021860 (Alteromonas sp. I4 plasmid pAltI4, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
taccggcaatgacttgagcgatagcgtcttt	Protospacer
.* ************** ****.*** . .*

450. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgatggcaacgacttcatcgatggcggcctc	Protospacer
*.*.*****.***** ***********. ..

451. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgatggcaacgacttcatcgatggcggcctc	Protospacer
*.*.*****.***** ***********. ..

452. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgatggcaacgacttcatcgatggcggcctc	Protospacer
*.*.*****.***** ***********. ..

453. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NC_009956 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI02, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgcgggcaatgatttcatcgatggcggcccg	Protospacer
*.  ********.** ***********. * 

454. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.742

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
cgatggcaacgacttcatcgatggcggcctc	Protospacer
*.*.*****.***** ***********. ..

455. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032350 (Azospirillum brasilense strain MTCC4039 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctggtcggcgactgg	Protospacer
 * .*************** ******..   

456. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
cagcggcgacgacacgctgctgggcggcgat	Protospacer
*...***.************* *****.. .

457. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctgctgggtggccag	Protospacer
 * .***************** **.**.   

458. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
catcggcaacgactcgctgatcggcggccgt	Protospacer
*. .********* ***** *******.  .

459. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacacgctgatcggcgactgg	Protospacer
*. .*************** ******..   

460. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggccggcaacgacacgctggtcggcgactgg	Protospacer
 * .*************** ******..   

461. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gtcgggcaacgacacgctgcagggcgggctg	Protospacer
    ****************  *****  * 

462. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcaacgacacgctggccggcggggcg	Protospacer
*  .*************** .****** .. 

463. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ttcgggcaacgacacgctggacggcggggcc	Protospacer
.   ***************  ****** ..*

464. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ttcgggcaacgacacgctggacggcggggcc	Protospacer
.   ***************  ****** ..*

465. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcaacgacacgctggccggcggggcg	Protospacer
*  .*************** .****** .. 

466. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaatgacacgctgatcggcggggcg	Protospacer
.*  *****.********* ******* .. 

467. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gtccggcgacgacacgctgatcggcggcacg	Protospacer
   .***.*********** *******.*. 

468. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gttcggcaacgacacgctggacggcggggcc	Protospacer
   .***************  ****** ..*

469. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022305 (Thalassococcus sp. S3 plasmid pS3B, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggatggtaacgacacgctgttcgggcagggc	Protospacer
 *****.************.****  . . *

470. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
agcgggcaacgacacgctgaccggcggagcg	Protospacer
 *  *************** .****** .. 

471. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gacgggcaacgacacgctgaacggcggcctt	Protospacer
 .  ***************  ******. *.

472. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015094 (Pelagibaca abyssi strain JLT2014 plasmid pPABY6, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcgacgacacgctgctgggcggggcg	Protospacer
 *..***.************* ***** .. 

473. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgatcggaggggcg	Protospacer
 *  *************** **** ** .. 

474. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gtcgggcgacgacacgctgatcggcggcgac	Protospacer
    ***.*********** *******.. *

475. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ttccggcaacgacacgctgatcggcggctat	Protospacer
.  .*************** *******.  .

476. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022542 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-2, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaccgacacgctggtcggcggcgcg	Protospacer
 *  **** ********** *******... 

477. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
attgggcaacgacacgctggacggcggtgcg	Protospacer
    ***************  *******.. 

478. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
agccggcaacgacacgctggacggcggcgcg	Protospacer
 * .***************  ******... 

479. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gctgggcgacgacacgctggtcggcggcggc	Protospacer
    ***.*********** *******.. *

480. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaaggacacgctgctcggcgtcccg	Protospacer
 *..***** **************** . . 

481. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgttcggcgaggat	Protospacer
 *  ***************.******. . .

482. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tggtggcaacgacacgctgatcggcaacggt	Protospacer
.*.**************** *****.... .

483. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gcttggcaacgacgtgctgctcggcggcgat	Protospacer
   **********..************.. .

484. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025613 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tagcggcaatgacacgctgatcggcggggcc	Protospacer
....*****.********* ******* ..*

485. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gtcgggcaacgacacgctgaacggcggggac	Protospacer
    ***************  ****** . *

486. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ccggggcaacgacacgctggacggcggcgcg	Protospacer
* . ***************  ******... 

487. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ggcgggcaacgacacgctgttcggcgaggat	Protospacer
 *  ***************.******. . .

488. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_008042 (Ruegeria sp. TM1040 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgcgggcaacgacacgctcttcggcggccca	Protospacer
.*  ************** .*******. . 

489. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacctgctgctcggcggcgcg	Protospacer
*. .********* .************... 

490. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacctgctgctcggcggcgcg	Protospacer
*. .********* .************... 

491. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacctgctgctcggcggcgcg	Protospacer
*. .********* .************... 

492. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacctgctgctcggcggcgcg	Protospacer
*. .********* .************... 

493. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gaccggcaacgacacggtgttcggcggcgac	Protospacer
 . .************ **.*******.. *

494. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tgccggcaccgacacgctgatcggcggctat	Protospacer
.* .**** ********** *******.  .

495. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP016366 (Phaeobacter porticola strain P97 plasmid pP97_b, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
ctccggcaacgacacgctgctgggtgggcat	Protospacer
*  .***************** **.**   .

496. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_022043 (Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gccgggcaatgacacgctggtcggcggacgc	Protospacer
    *****.********* *******   *

497. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacctgctgctcggcggcgcg	Protospacer
*. .********* .************... 

498. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacctgctgctcggcggcgcg	Protospacer
*. .********* .************... 

499. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
gggcggcaacgacacgatactcggcggcgcg	Protospacer
 *..************ *.********... 

500. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
caccggcaacgacctgctgctcggcggcgcg	Protospacer
*. .********* .************... 

501. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 9, identity: 0.71

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
atcaggctacgacacgcagctcggcggcaat	Protospacer
    *** ********* *********.* .

502. spacer 3.2|3025870|31|CP029482|CRISPRCasFinder matches to NZ_CP034782 (Pseudomonas sp. MPC6 plasmid pMPC6-328K, complete sequence) position: , mismatch: 9, identity: 0.71

caacggcaatgacttgatcgatggcggtgct	CRISPR spacer
taccggagatgacttgatcgatggcgcctac	Protospacer
.* *** .****************** .  .

503. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NC_007100 (Pseudomonas aeruginosa plasmid Rms149, complete sequence) position: , mismatch: 10, identity: 0.677

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tacgggcaacgacacgctggtcggtggccgg	Protospacer
..  *************** ****.**.   

504. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP019319 (Tateyamaria omphalii strain DOK1-4 plasmid pDOK1-4-7, complete sequence) position: , mismatch: 10, identity: 0.677

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
atccggcaatgacacgctgcgcggcggcgcg	Protospacer
   .*****.********** ******... 

505. spacer 3.1|3025816|31|CP029482|CRISPRCasFinder matches to NZ_CP028919 (Gemmobacter sp. HYN0069 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.677

cgatggcaacgacacgctgctcggcggtatc	CRISPR spacer
tagcggcaacgacacgctggacggcggcggg	Protospacer
....***************  ******..  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1475015 : 1541598 65 Pseudomonas_phage(50.0%) plate,lysis,holin,tail,tRNA NA
DBSCAN-SWA_2 2653182 : 2659447 8 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_3 3513512 : 3522939 9 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_4 6340781 : 6398000 51 Tupanvirus(20.0%) protease,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage