Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029491 Streptococcus sobrinus strain 10919 chromosome, complete genome 2 crisprs DEDDh,cas3,csa3,DinG,csm6 0 2 5 0

Results visualization

1. CP029491
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029491_1 163545-163615 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029491_2 439629-439712 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029491_1 1.1|163568|25|CP029491|CRISPRCasFinder 163568-163592 25 MH648987 Siphoviridae sp. isolate ctcj11, complete genome 23844-23868 3 0.88
CP029491_2 2.1|439658|26|CP029491|CRISPRCasFinder 439658-439683 26 NZ_CP053834 Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence 159084-159109 6 0.769

1. spacer 1.1|163568|25|CP029491|CRISPRCasFinder matches to MH648987 (Siphoviridae sp. isolate ctcj11, complete genome) position: , mismatch: 3, identity: 0.88

gagcttgaaaactgggaagcgaggc	CRISPR spacer
gagcttgataactgggaagcgatac	Protospacer
******** ************* .*

2. spacer 2.1|439658|26|CP029491|CRISPRCasFinder matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 6, identity: 0.769

tttcatttccaacttttgacagtctc	CRISPR spacer
tttcatttacaacttttgacatctct	Protospacer
******** ************ ....

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 49207 : 57776 9 Mollivirus(16.67%) NA NA
DBSCAN-SWA_2 630251 : 680291 48 Enterococcus_phage(20.0%) protease,bacteriocin,transposase NA
DBSCAN-SWA_3 1008798 : 1019388 9 Bacillus_phage(28.57%) tRNA NA
DBSCAN-SWA_4 1152166 : 1203051 56 Bacillus_virus(10.0%) protease,tRNA,transposase,bacteriocin NA
DBSCAN-SWA_5 1764934 : 1839882 59 Streptococcus_phage(20.0%) protease,tRNA,transposase,bacteriocin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage