Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029604 Gordonia terrae strain NRRL B-16283 chromosome, complete genome 10 crisprs csa3,cas3,DinG,DEDDh,cas4,WYL,RT 0 2 2 0

Results visualization

1. CP029604
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_1 712631-712744 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_3 1694284-1694377 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_4 2615732-2615834 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_5 2823362-2823461 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_6 2875598-2875749 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_7 3336786-3336893 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_8 3961409-3961533 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_9 4912678-4912808 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_10 5026609-5026740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029604_11 5603234-5603297 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029604_10 10.1|5026659|32|CP029604|CRISPRCasFinder 5026659-5026690 32 NC_047751 Ralstonia phage phiITL-1, complete genome 24152-24183 5 0.844
CP029604_8 8.2|3961484|30|CP029604|PILER-CR 3961484-3961513 30 MH834627 Arthrobacter phage Ryan, complete genome 7358-7387 6 0.8
CP029604_8 8.2|3961484|30|CP029604|PILER-CR 3961484-3961513 30 NZ_CP012185 Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence 372208-372237 7 0.767
CP029604_8 8.2|3961484|30|CP029604|PILER-CR 3961484-3961513 30 NZ_CP012182 Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence 675201-675230 7 0.767
CP029604_8 8.2|3961484|30|CP029604|PILER-CR 3961484-3961513 30 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 414461-414490 8 0.733

1. spacer 10.1|5026659|32|CP029604|CRISPRCasFinder matches to NC_047751 (Ralstonia phage phiITL-1, complete genome) position: , mismatch: 5, identity: 0.844

gcaagcgccacccccaactgatcgagcgagcg-	CRISPR spacer
acaaccgccaccccgaactgatcg-gccagcgc	Protospacer
.*** ********* ********* ** **** 

2. spacer 8.2|3961484|30|CP029604|PILER-CR matches to MH834627 (Arthrobacter phage Ryan, complete genome) position: , mismatch: 6, identity: 0.8

actgggccgagggcctggggccacacgccg	CRISPR spacer
gtcaggccgagggcctggggccactcgcca	Protospacer
....******************** ****.

3. spacer 8.2|3961484|30|CP029604|PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.767

actgggccgagggcctggggccacacgccg	CRISPR spacer
gcctggaccagggcctggggccacacggtg	Protospacer
.*. ** * ****************** .*

4. spacer 8.2|3961484|30|CP029604|PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.767

actgggccgagggcctggggccacacgccg	CRISPR spacer
gcctggaccagggcctggggccacacggtg	Protospacer
.*. ** * ****************** .*

5. spacer 8.2|3961484|30|CP029604|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.733

actgggccgagggcctggggccacacgccg	CRISPR spacer
gggaggacgggggcctggggccacacgatg	Protospacer
.  .** **.***************** .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 75574 : 122234 38 Gordonia_phage(42.86%) transposase NA
DBSCAN-SWA_2 3764359 : 3773410 7 Gordonia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage