Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029621 Haemophilus influenzae strain 84P36H1 chromosome, complete genome 2 crisprs cas3,RT,DEDDh 0 1 10 0

Results visualization

1. CP029621
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029621_1 985655-985746 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029621_2 1445888-1445968 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029621_2 2.1|1445912|33|CP029621|CRISPRCasFinder 1445912-1445944 33 MH572422 Microviridae sp. isolate SD_MC_8, complete genome 4167-4199 9 0.727

1. spacer 2.1|1445912|33|CP029621|CRISPRCasFinder matches to MH572422 (Microviridae sp. isolate SD_MC_8, complete genome) position: , mismatch: 9, identity: 0.727

catcgccattaagtaccacgaaatctttcgccg	CRISPR spacer
ttttaccattaagtaccacaaaatcattcggat	Protospacer
. *..**************.***** ****   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20848 : 29680 9 Acinetobacter_phage(50.0%) NA NA
DBSCAN-SWA_2 42305 : 55297 19 Haemophilus_phage(33.33%) terminase,holin NA
DBSCAN-SWA_3 378764 : 478227 98 Burkholderia_phage(25.58%) plate,protease,transposase,tail NA
DBSCAN-SWA_4 863728 : 978312 102 Haemophilus_phage(31.82%) plate,transposase,protease,tRNA,head,tail NA
DBSCAN-SWA_5 989465 : 1025456 35 Shigella_phage(26.09%) plate,transposase,tRNA,head,tail NA
DBSCAN-SWA_6 1032685 : 1040597 11 Haemophilus_phage(37.5%) NA NA
DBSCAN-SWA_7 1305285 : 1321015 22 Mannheimia_phage(18.75%) terminase NA
DBSCAN-SWA_8 1330780 : 1338742 9 Haemophilus_phage(37.5%) plate NA
DBSCAN-SWA_9 1619242 : 1727503 64 Burkholderia_virus(15.38%) plate,protease,tail,tRNA NA
DBSCAN-SWA_10 1731176 : 1743941 17 Burkholderia_phage(40.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage