Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029692 Escherichia coli strain SD134209 chromosome, complete genome 3 crisprs DinG,PrimPol,cas3,c2c9_V-U4,DEDDh,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas14i 0 5 17 0
CP029691 Escherichia coli strain SD134209 plasmid pSD134209-2, complete sequence 0 crisprs NA 0 0 1 0
CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 1 crisprs NA 0 2 0 0

Results visualization

1. CP029692
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029692_1 1768361-1768484 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029692_2 3437013-3437285 TypeI-E I-E
4 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029692_3 3462987-3463381 Unclear I-E
6 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029692_1 1.1|1768404|38|CP029692|CRISPRCasFinder 1768404-1768441 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP029692_2 2.1|3437042|32|CP029692|PILER-CR,CRISPRCasFinder,CRT 3437042-3437073 32 NZ_CP050442 Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence 41503-41534 6 0.812
CP029692_3 3.1|3463016|32|CP029692|CRISPRCasFinder 3463016-3463047 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP029692_2 2.2|3437103|32|CP029692|PILER-CR,CRISPRCasFinder,CRT 3437103-3437134 32 LT599585 Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid 32377-32408 9 0.719
CP029692_2 2.3|3437164|32|CP029692|PILER-CR,CRISPRCasFinder,CRT 3437164-3437195 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 292180-292211 9 0.719
CP029692_2 2.3|3437164|32|CP029692|PILER-CR,CRISPRCasFinder,CRT 3437164-3437195 32 NZ_CP020740 [Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence 20747-20778 9 0.719

1. spacer 1.1|1768404|38|CP029692|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

2. spacer 2.1|3437042|32|CP029692|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812

aaaaccaaacttctccataaattccatagccg	CRISPR spacer
attactaaacttctgcataaattccataggag	Protospacer
*  **.******** **************  *

3. spacer 3.1|3463016|32|CP029692|CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

4. spacer 2.2|3437103|32|CP029692|PILER-CR,CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719

gagagtgctgacaggtgtctcgattacctgat	CRISPR spacer
ggctttgctggcaggtctctcgattaccttgg	Protospacer
*.   *****.***** ************ . 

5. spacer 2.3|3437164|32|CP029692|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
atcggcaatatcacggcgtttttcggcgccgc	Protospacer
.   ****************.* **** .** 

6. spacer 2.3|3437164|32|CP029692|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020740 ([Pseudomonas] mesoacidophila strain ATCC 31433 plasmid pATCC31433, complete sequence) position: , mismatch: 9, identity: 0.719

gaacgcaatatcacggcgttctgcggcctcgg	CRISPR spacer
accggcaacatcacggcgttcttcggcgccgc	Protospacer
.   ****.************* **** .** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 328800 : 373540 48 Escherichia_phage(23.53%) transposase,holin NA
DBSCAN-SWA_2 558229 : 638121 74 Escherichia_phage(33.33%) protease,transposase,tRNA,tail,capsid,head NA
DBSCAN-SWA_3 857655 : 891724 44 Enterobacteria_phage(56.76%) transposase,integrase,tail,capsid,head,holin attL 873671:873687|attR 895673:895689
DBSCAN-SWA_4 1104020 : 1146579 62 Escherichia_phage(37.93%) lysis,protease,transposase,holin NA
DBSCAN-SWA_5 1375077 : 1424310 61 Escherichia_phage(34.0%) terminase,transposase,integrase,tail,capsid,head,lysis,holin attL 1370171:1370185|attR 1376652:1376666
DBSCAN-SWA_6 1681378 : 1718477 45 Enterobacteria_phage(88.57%) terminase,portal,tRNA,plate,tail,capsid,holin NA
DBSCAN-SWA_7 1841958 : 1920170 86 Stx2-converting_phage(38.46%) terminase,protease,portal,transposase,integrase,tail,capsid,head,lysis,holin attL 1867830:1867859|attR 1924852:1924881
DBSCAN-SWA_8 1925457 : 1944834 25 Escherichia_phage(41.18%) tail,transposase NA
DBSCAN-SWA_9 2142943 : 2203245 78 Escherichia_phage(40.58%) terminase,transposase,tRNA,tail,capsid,head,lysis,holin NA
DBSCAN-SWA_10 2263629 : 2337958 84 Enterobacteria_phage(43.64%) terminase,protease,portal,transposase,tail,lysis,holin NA
DBSCAN-SWA_11 2439174 : 2507141 84 Enterobacteria_phage(33.87%) terminase,portal,transposase,tRNA,tail,capsid,head,lysis,holin NA
DBSCAN-SWA_12 2515205 : 2582953 94 Enterobacteria_phage(47.83%) terminase,portal,transposase,coat,tail,head,lysis,holin NA
DBSCAN-SWA_13 2784758 : 2846261 57 Enterobacteria_phage(23.08%) terminase,transposase,integrase,capsid,lysis,holin attL 2815339:2815374|attR 2847201:2847236
DBSCAN-SWA_14 2934936 : 3027007 110 Escherichia_phage(38.27%) terminase,bacteriocin,portal,transposase,tRNA,tail,capsid,lysis,holin NA
DBSCAN-SWA_15 3256695 : 3341995 92 Enterobacteria_phage(75.0%) terminase,portal,tRNA,tail,lysis NA
DBSCAN-SWA_16 3413523 : 3420663 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_17 4947199 : 5004826 69 Stx2-converting_phage(34.69%) terminase,tRNA,integrase,tail,capsid,head,lysis,holin attL 4950616:4950630|attR 5006482:5006496
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029690
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029690_1 175804-175961 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 81476-81526 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 182983-183033 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 180762-180812 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 96276-96326 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 235796-235846 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 42635-42685 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 152742-152792 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 142863-142913 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 133710-133760 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 117174-117224 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 192529-192579 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 11544-11594 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 MN232190 Escherichia coli plasmid pGD27-31, complete sequence 77135-77185 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 247816-247866 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 175824-175874 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 29608-29658 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 195030-195080 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 160405-160455 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 229056-229106 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 1240-1290 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 150895-150945 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 222888-222938 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 157698-157748 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 163625-163675 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 139403-139453 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 103197-103247 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NC_002305 Salmonella typhi plasmid R27, complete sequence 54047-54097 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 156262-156312 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 114948-114998 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 99282-99332 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 190141-190191 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 186842-186892 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 163174-163224 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 95412-95462 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 154888-154938 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 135342-135392 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 101555-101605 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 111577-111627 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 163625-163675 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 192086-192136 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 157699-157749 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 237889-237939 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 79517-79567 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 27631-27681 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 106159-106209 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 267735-267785 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 173816-173866 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 95376-95426 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 230101-230151 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 20571-20621 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 1141-1191 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 259337-259387 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 210872-210922 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 110178-110228 0 1.0
CP029690_1 1.1|175824|51|CP029690|PILER-CR 175824-175874 51 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 111658-111708 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP026790 Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence 42568-42614 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP039717 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence 152675-152721 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 KP899804 Salmonella enterica strain F8475 plasmid pF8475, complete sequence 142796-142842 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 KP899805 Salmonella enterica strain 109/9 plasmid p109/9, complete sequence 133643-133689 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 KP899806 Salmonella enterica strain B71 plasmid pB71, complete sequence 117107-117153 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP037875 Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence 192462-192508 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP018652 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence 11477-11523 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP039559 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence 150828-150874 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 MN256758 Escherichia coli strain 4M8F plasmid p4M8F, complete sequence 163558-163604 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 MN256759 Escherichia coli strain 4M9F plasmid p4M9F, complete sequence 139336-139382 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP046007 Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence 103130-103176 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NC_002305 Salmonella typhi plasmid R27, complete sequence 53980-54026 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 LT905061 Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2 190074-190120 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP022495 Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence 154821-154867 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP016184 Escherichia coli strain EC2 plasmid pEC2-4, complete sequence 135275-135321 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP016183 Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence 101488-101534 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 MN256757 Escherichia coli strain 4M18F plasmid p4M18F, complete sequence 163558-163604 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NC_016825 Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence 79450-79496 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 230034-230080 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 MT219824 Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence 110111-110157 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_LT904879 Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2 81547-81593 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_KX129784 Escherichia coli strain H226B plasmid pH226B, complete sequence 183054-183100 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NC_009981 Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence 180833-180879 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029645 Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029729 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence 96347-96393 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 235867-235913 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 MN232190 Escherichia coli plasmid pGD27-31, complete sequence 77206-77252 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 247887-247933 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029690 Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence 175895-175941 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NC_003384 Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence 29679-29725 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP030182 Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence 195101-195147 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP049354 Escherichia coli strain T28R plasmid pT28R-1, complete sequence 160476-160522 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP023167 Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence 229127-229173 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 AP020333 Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome 1311-1357 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP037911 Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence 222959-223005 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP046717 Escherichia coli strain T16R plasmid pT16R-1, complete sequence 157769-157815 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP046004 Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence 156333-156379 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP024236 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence 115019-115065 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029895 Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029877 Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP033094 Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence 99353-99399 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029926 Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence 186913-186959 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029947 Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP044968 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence 163245-163291 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP044958 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence 95483-95529 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029943 Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029953 Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029955 Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029924 Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence 111648-111694 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029934 Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NC_013365 Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence 192157-192203 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP041449 Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence 157770-157816 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029939 Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029957 Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029941 Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029910 Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029887 Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029948 Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029937 Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029879 Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP018656 Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence 237960-238006 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029931 Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_CP029935 Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence 27702-27748 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_LT985296 Escherichia coli strain 1454 plasmid RCS78_p, complete sequence 106230-106276 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_MN101858 Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence 267806-267852 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_MN101856 Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence 173887-173933 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_MH733010 Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence 95447-95493 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_MG904992 Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence 20642-20688 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NZ_MG948335 Escherichia coli strain 3498 plasmid p3498, complete sequence 1212-1258 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NC_023277 Escherichia coli strain 63743 plasmid pEQ2, complete sequence 259408-259454 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 NC_023289 Escherichia coli strain T23 plasmid pEQ1, complete sequence 210943-210989 0 1.0
CP029690_1 1.2|175895|47|CP029690|PILER-CR 175895-175941 47 MG874042 Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence 111729-111775 0 1.0

1. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

2. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

3. spacer 1.1|175824|51|CP029690|PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

4. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

5. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

6. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

7. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

8. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

9. spacer 1.1|175824|51|CP029690|PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

10. spacer 1.1|175824|51|CP029690|PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

11. spacer 1.1|175824|51|CP029690|PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

12. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

13. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

14. spacer 1.1|175824|51|CP029690|PILER-CR matches to MN232190 (Escherichia coli plasmid pGD27-31, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

15. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

16. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

17. spacer 1.1|175824|51|CP029690|PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

18. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

19. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

20. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

21. spacer 1.1|175824|51|CP029690|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

22. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

23. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

24. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

25. spacer 1.1|175824|51|CP029690|PILER-CR matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

26. spacer 1.1|175824|51|CP029690|PILER-CR matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

27. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

28. spacer 1.1|175824|51|CP029690|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

29. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

30. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

31. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

32. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

33. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

34. spacer 1.1|175824|51|CP029690|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

35. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

36. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

37. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

38. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

39. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

40. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

41. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

42. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

43. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

44. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

45. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

46. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

47. spacer 1.1|175824|51|CP029690|PILER-CR matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

48. spacer 1.1|175824|51|CP029690|PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

49. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

50. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

51. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

52. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

53. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

54. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

55. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

56. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

57. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

58. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

59. spacer 1.1|175824|51|CP029690|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

60. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

61. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

62. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

63. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

64. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

65. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

66. spacer 1.1|175824|51|CP029690|PILER-CR matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

67. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

68. spacer 1.1|175824|51|CP029690|PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

69. spacer 1.1|175824|51|CP029690|PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

70. spacer 1.1|175824|51|CP029690|PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

71. spacer 1.1|175824|51|CP029690|PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

72. spacer 1.1|175824|51|CP029690|PILER-CR matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	CRISPR spacer
gagaactactgctaatcggttaccgggaatgtggtggtactgggtggaaag	Protospacer
***************************************************

73. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP026790 (Shigella flexneri 2a strain ATCC 29903 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

74. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP039717 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS000211 plasmid p10-3184.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

75. spacer 1.2|175895|47|CP029690|PILER-CR matches to KP899804 (Salmonella enterica strain F8475 plasmid pF8475, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

76. spacer 1.2|175895|47|CP029690|PILER-CR matches to KP899805 (Salmonella enterica strain 109/9 plasmid p109/9, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

77. spacer 1.2|175895|47|CP029690|PILER-CR matches to KP899806 (Salmonella enterica strain B71 plasmid pB71, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

78. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP037875 (Salmonella enterica subsp. enterica serovar 4,[5],12:i:- strain PNCS015054 plasmid pPNCS015054_S2, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

79. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP018652 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1705 plasmid pSE81-1705-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

80. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP039559 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014846 plasmid p08-4425.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

81. spacer 1.2|175895|47|CP029690|PILER-CR matches to MN256758 (Escherichia coli strain 4M8F plasmid p4M8F, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

82. spacer 1.2|175895|47|CP029690|PILER-CR matches to MN256759 (Escherichia coli strain 4M9F plasmid p4M9F, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

83. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP046007 (Escherichia coli strain 1919D62 plasmid p1919D62-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

84. spacer 1.2|175895|47|CP029690|PILER-CR matches to NC_002305 (Salmonella typhi plasmid R27, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

85. spacer 1.2|175895|47|CP029690|PILER-CR matches to LT905061 (Salmonella enterica subsp. enterica serovar Typhi isolate ISP_03_07467_SGB110-sc-1979083 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

86. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP022495 (Salmonella enterica subsp. enterica serovar Derby strain SA20035215 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

87. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP016184 (Escherichia coli strain EC2 plasmid pEC2-4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

88. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP016183 (Escherichia coli strain EC2_1 plasmid pEC2_1-4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

89. spacer 1.2|175895|47|CP029690|PILER-CR matches to MN256757 (Escherichia coli strain 4M18F plasmid p4M18F, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

90. spacer 1.2|175895|47|CP029690|PILER-CR matches to NC_016825 (Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

91. spacer 1.2|175895|47|CP029690|PILER-CR matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

92. spacer 1.2|175895|47|CP029690|PILER-CR matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

93. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_LT904879 (Salmonella enterica subsp. enterica serovar Typhi strain ty3-193 genome assembly, plasmid: 2) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

94. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

95. spacer 1.2|175895|47|CP029690|PILER-CR matches to NC_009981 (Salmonella enterica subsp. enterica serovar Choleraesuis plasmid pMAK1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

96. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029645 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_217186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

97. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029729 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

98. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

99. spacer 1.2|175895|47|CP029690|PILER-CR matches to MN232190 (Escherichia coli plasmid pGD27-31, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

100. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

101. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029690 (Escherichia coli strain SD134209 plasmid pSD134209-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

102. spacer 1.2|175895|47|CP029690|PILER-CR matches to NC_003384 (Salmonella enterica subsp. enterica serovar Typhi str. CT18 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

103. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP030182 (Salmonella enterica strain SA20030575 plasmid pSA20030575.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

104. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP049354 (Escherichia coli strain T28R plasmid pT28R-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

105. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP023167 (Salmonella enterica subsp. enterica serovar Saintpaul strain SGB23 plasmid pSGB23, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

106. spacer 1.2|175895|47|CP029690|PILER-CR matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

107. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP037911 (Escherichia coli strain YSP8-1 plasmid pYSP8-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

108. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP046717 (Escherichia coli strain T16R plasmid pT16R-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

109. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP046004 (Escherichia coli strain 1919D3 plasmid p1919D3-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

110. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP024236 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

111. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029895 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_252186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

112. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029877 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_224186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

113. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP033094 (Escherichia coli strain CP53 plasmid pCP53-mcr, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

114. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029926 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_218186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

115. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029947 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_210186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

116. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP044968 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007098 plasmid pPNCS014881.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

117. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP044958 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS007087 plasmid pPNCS007087.1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

118. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029943 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_212186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

119. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029953 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_204186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

120. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029955 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_202186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

121. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029924 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_221186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

122. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029934 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_214186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

123. spacer 1.2|175895|47|CP029690|PILER-CR matches to NC_013365 (Escherichia coli O111:H- str. 11128 plasmid pO111_1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

124. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP041449 (Escherichia coli strain YPE10 plasmid pYPE10-190k-tetX4, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

125. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029939 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_206186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

126. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029957 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_201186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

127. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029941 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_203186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

128. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029910 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_219186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

129. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029887 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_220186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

130. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029948 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_208186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

131. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029937 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_207186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

132. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029879 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_223186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

133. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP018656 (Salmonella enterica subsp. enterica serovar Enteritidis strain 81-1706 plasmid pSE81-1706, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

134. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029931 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_215186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

135. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_CP029935 (Salmonella enterica subsp. enterica serovar Typhi strain 311189_213186 plasmid pHCM1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

136. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_LT985296 (Escherichia coli strain 1454 plasmid RCS78_p, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

137. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

138. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_MN101856 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-190, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

139. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_MH733010 (Klebsiella pneumoniae strain KP14812 plasmid pKP14812-MCR-1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

140. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_MG904992 (Escherichia coli strain 14OD0056 plasmid p14ODMR, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

141. spacer 1.2|175895|47|CP029690|PILER-CR matches to NZ_MG948335 (Escherichia coli strain 3498 plasmid p3498, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

142. spacer 1.2|175895|47|CP029690|PILER-CR matches to NC_023277 (Escherichia coli strain 63743 plasmid pEQ2, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

143. spacer 1.2|175895|47|CP029690|PILER-CR matches to NC_023289 (Escherichia coli strain T23 plasmid pEQ1, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

144. spacer 1.2|175895|47|CP029690|PILER-CR matches to MG874042 (Salmonella sp. strain Sa4 plasmid pSa4-CIP, complete sequence) position: , mismatch: 0, identity: 1.0

cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	CRISPR spacer
cgtggcagtgtcatctttccggatagcatgacgtcacggttaggaaa	Protospacer
***********************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP029691
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2288 : 39693 50 Escherichia_phage(36.36%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage