Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029773 Stenotrophomonas maltophilia strain SJTL3 chromosome, complete genome 9 crisprs DEDDh,csa3,WYL,cas3,PD-DExK,Cas9_archaeal,DinG 0 1 4 0

Results visualization

1. CP029773
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_2 733538-733678 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_3 789641-789763 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_4 1311310-1311400 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_5 2263905-2264009 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_6 2706212-2706318 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_7 3099761-3099869 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_8 3117481-3117575 Orphan NA
1 spacers
DEDDh,csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_9 4018663-4018751 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029773_10 4432793-4432903 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029773_3 3.1|789685|35|CP029773|CRISPRCasFinder 789685-789719 35 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 250878-250912 11 0.686

1. spacer 3.1|789685|35|CP029773|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.686

agcggccggcactacccccatccacgcatggtagg	CRISPR spacer
ataggccgccaccacccccatccacgcaccacgct	Protospacer
*  ***** ***.***************. ...  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 560697 : 572786 9 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_2 923337 : 966528 30 Agrobacterium_phage(10.0%) transposase,integrase,protease,portal attL 939583:939596|attR 967151:967164
DBSCAN-SWA_3 999326 : 1017378 22 Escherichia_phage(35.71%) integrase,plate,tail attL 1003210:1003225|attR 1018859:1018874
DBSCAN-SWA_4 2339952 : 2351873 21 Stenotrophomonas_phage(72.73%) integrase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage