1. spacer 3.35|1360988|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NC_017762 (Helicobacter cinaedi PAGU611 plasmid pHci1, complete sequence) position: , mismatch: 0, identity: 1.0
aaatatgatgtatgcatgtgagtgtccaag CRISPR spacer
aaatatgatgtatgcatgtgagtgtccaag Protospacer
******************************
2. spacer 4.7|1837127|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to NC_017762 (Helicobacter cinaedi PAGU611 plasmid pHci1, complete sequence) position: , mismatch: 0, identity: 1.0
aaaatgtgaagtgtgtgggaataatattaa CRISPR spacer
aaaatgtgaagtgtgtgggaataatattaa Protospacer
******************************
3. spacer 3.27|1360459|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MG945779 (UNVERIFIED: Microviridae sp. isolate 4059-1602, complete genome) position: , mismatch: 1, identity: 0.967
ataataagtcgtcattatagaatccatacc CRISPR spacer
ataataagtcgtcataatagaatccatacc Protospacer
*************** **************
4. spacer 4.3|1836863|30|AP018676|CRISPRCasFinder,CRT matches to KC465899 (Pelagibacter phage HTVC008M, complete genome) position: , mismatch: 5, identity: 0.833
-gcaagagtttcttttaaataaagatagtaa CRISPR spacer
tgctaca-tttgttttaaataaagatagtac Protospacer
** * * *** ******************
5. spacer 3.6|1359066|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
catttgagattctagcgcttggccgagacc CRISPR spacer
ctcttgagattccagcgcttggccgtgccg Protospacer
* .*********.************ * *
6. spacer 3.19|1359930|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP015439 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence) position: , mismatch: 6, identity: 0.8
cacttatttcaaaagaaaagcaatgcggac CRISPR spacer
ggattatttcaaaagaaaatcaacgcggaa Protospacer
. **************** ***.*****
7. spacer 3.21|1360062|31|AP018676|CRT matches to MN694538 (Marine virus AFVG_250M546, complete genome) position: , mismatch: 6, identity: 0.806
tacaaggc-atatatgataatagaagcaatgg CRISPR spacer
-actattcgatataagataatagaagcattgg Protospacer
** * * ***** ************* ***
8. spacer 3.30|1360657|31|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MN694776 (Marine virus AFVG_250M599, complete genome) position: , mismatch: 6, identity: 0.806
tggtgttctcggatatatgggag----caaaaggt CRISPR spacer
tggtgttctcggatatctgggaaataccaaa---- Protospacer
**************** *****. ****
9. spacer 3.38|1361186|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MN585972 (Arthrobacter phage Edmundo, complete genome) position: , mismatch: 6, identity: 0.8
aggggcagataacgattacagcgtggcgat CRISPR spacer
aggggcagataacgagtccagcgttgacgt Protospacer
*************** * ****** * .*
10. spacer 3.41|1361384|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 6, identity: 0.8
agagaaaagagagacccagaaccaaacgag CRISPR spacer
cgagaaaagacagacctagaaccaatcaaa Protospacer
********* *****.******** *.*.
11. spacer 3.41|1361384|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 6, identity: 0.8
agagaaaagagagacccagaaccaaacgag CRISPR spacer
cgagaaaagacagacctagaaccaatcaaa Protospacer
********* *****.******** *.*.
12. spacer 4.3|1836863|30|AP018676|CRISPRCasFinder,CRT matches to MT774379 (CrAssphage cr118_1, complete genome) position: , mismatch: 6, identity: 0.8
gcaagagtttcttttaaataaagatagtaa CRISPR spacer
aaaagaattacttttaaataaagataaaaa Protospacer
. ****.** ****************. **
13. spacer 4.9|1837259|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to KJ473422 (Acinetobacter phage vB_AbaM_Acibel004, complete genome) position: , mismatch: 6, identity: 0.8
ttttaaaattttaagcccttgag---atacgcg CRISPR spacer
ttttaaaatttttagaccttgagtttatat--- Protospacer
************ ** ******* ***.
14. spacer 4.10|1837325|30|AP018676|CRT matches to NZ_CP039728 (Bacillus sp. S3 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8
--agctcctcttttgaagcattctcattttta CRISPR spacer
ttagtt--tcttttgaatcattctcttttttt Protospacer
**.* ********* ******* *****
15. spacer 3.7|1359132|30|AP018676|CRISPRCasFinder,CRT matches to MN694537 (Marine virus AFVG_250M1002, complete genome) position: , mismatch: 7, identity: 0.767
aatactgtctctgctgttcactatttttag CRISPR spacer
caaactgtctctgctgttcaccattaggac Protospacer
* ******************.*** *
16. spacer 3.15|1359665|30|AP018676|CRISPRCasFinder,CRT matches to MN693827 (Marine virus AFVG_250M166, complete genome) position: , mismatch: 7, identity: 0.767
-cgacagcgtagaattaattagggcaaatga CRISPR spacer
gtaacgg-gtagaattaattaggggaaattt Protospacer
..**.* **************** ****
17. spacer 3.15|1359665|30|AP018676|CRISPRCasFinder,CRT matches to JN202312 (Enterobacteria phage ime09, complete genome) position: , mismatch: 7, identity: 0.767
cgacagcgtagaattaattagggcaaatga CRISPR spacer
ggatgtggtataattaattggggcaaatga Protospacer
**.. *** ********.**********
18. spacer 3.19|1359930|30|AP018676|CRISPRCasFinder,CRT matches to NC_009425 (Enterobacter sp. 638 plasmid pENTE01, complete sequence) position: , mismatch: 7, identity: 0.767
cacttatttcaaaagaaaagcaatgcggac CRISPR spacer
aaattatttcaaaagaaaatcactgctaaa Protospacer
* **************** ** *** .*
19. spacer 3.23|1360195|30|AP018676|CRT,CRISPRCasFinder matches to NZ_CP049251 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
gagaaagatatggaagaacatcgctgggga----- CRISPR spacer
gaggaagatattgaagaacatc-----ggagcttt Protospacer
***.******* ********** ***
20. spacer 3.31|1360724|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to CP053577 (Salmonella enterica strain 2012K-0845 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.767
cttcctgcataccgataccactgagctccg CRISPR spacer
cagcctgcataccgatatcaccgagcttga Protospacer
* **************.***.*****. .
21. spacer 3.32|1360790|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP039853 (Salinimonas sp. KX18D6 plasmid plas12, complete sequence) position: , mismatch: 7, identity: 0.767
tattgaatacacaagcataaaaggaaatat CRISPR spacer
aagccaatacacaagcataaaaagaactaa Protospacer
* . *****************.*** **
22. spacer 3.32|1360790|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NC_015498 (Glaciecola sp. 4H-3-7+YE-5 plasmid pGLAAG01, complete sequence) position: , mismatch: 7, identity: 0.767
tattgaatacacaagcataaaaggaaatat CRISPR spacer
aagccaatacacaagcataaaaagaactaa Protospacer
* . *****************.*** **
23. spacer 3.33|1360856|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MT774408 (CrAssphage cr130_1, complete genome) position: , mismatch: 7, identity: 0.767
tgctaccggcacaatatgccttgaatttga CRISPR spacer
ggagttcggcacaatataccttaaatttga Protospacer
* .***********.****.*******
24. spacer 3.36|1361054|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_AP017611 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence) position: , mismatch: 7, identity: 0.767
gtctgcgaataaaaaatcgacgttttctgc CRISPR spacer
gtaacttaataaaagatcgaagttttctgc Protospacer
** . *******.***** *********
25. spacer 3.36|1361054|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP051729 (Escherichia coli strain SCU-111 plasmid pSCU-111-2, complete sequence) position: , mismatch: 7, identity: 0.767
gtctgcgaataaaaaatcgacgttttctgc CRISPR spacer
gtaacttaataaaagatcgaagttttctgc Protospacer
** . *******.***** *********
26. spacer 3.47|1361780|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP014767 (Pontibacter akesuensis strain AKS 1T plasmid Paks1, complete sequence) position: , mismatch: 7, identity: 0.767
ggaaatatactctttataagaaaaattttc CRISPR spacer
aaaaatatattctttataagaataataata Protospacer
..*******.************ *** *
27. spacer 3.47|1361780|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NC_014757 (Bacillus cereus VPC1401 plasmid pLVP1401 complete sequence) position: , mismatch: 7, identity: 0.767
ggaaatatactctttataagaaaaattttc CRISPR spacer
ccatggatagtctttataagaaaaactttc Protospacer
* . *** ***************.****
28. spacer 3.47|1361780|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP012102 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-3, complete sequence) position: , mismatch: 7, identity: 0.767
ggaaatatactctttataagaaaaattttc CRISPR spacer
ccatggatagtctttataagaaaaactttc Protospacer
* . *** ***************.****
29. spacer 3.47|1361780|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MG945508 (UNVERIFIED: Microviridae sp. isolate 1754-1801, complete genome) position: , mismatch: 7, identity: 0.767
ggaaatatactctttataagaaaaattttc CRISPR spacer
gtattgctactctttataaaaaagattttc Protospacer
* * ************.***.******
30. spacer 4.1|1836731|30|AP018676|CRISPRCasFinder,CRT matches to CP008938 (Candidatus Caedibacter acanthamoebae plasmid Plasmid_00002, complete sequence) position: , mismatch: 7, identity: 0.767
attgcaaataataatctcatcaatgctttg CRISPR spacer
ggttctaataataatctcaacactgcttta Protospacer
. * * ************* ** ******.
31. spacer 4.9|1837259|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to KF751797 (Campylobacter phage CJIE4-5, complete genome) position: , mismatch: 7, identity: 0.767
ttttaaaattttaagcccttgagatacgcg CRISPR spacer
ttttaaaattttaagcgcttgagaatttaa Protospacer
**************** ******* . .
32. spacer 4.9|1837259|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to KF751794 (Campylobacter phage CJIE4-2, complete genome) position: , mismatch: 7, identity: 0.767
ttttaaaattttaagcccttgagatacgcg CRISPR spacer
ttttaaaattttaagcgcttgagaatttaa Protospacer
**************** ******* . .
33. spacer 4.9|1837259|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to KF751795 (Campylobacter phage CJIE4-3, complete genome) position: , mismatch: 7, identity: 0.767
ttttaaaattttaagcccttgagatacgcg CRISPR spacer
ttttaaaattttaagcgcttgagaatttaa Protospacer
**************** ******* . .
34. spacer 4.9|1837259|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to KF751796 (Campylobacter phage CJIE4-4, complete genome) position: , mismatch: 7, identity: 0.767
ttttaaaattttaagcccttgagatacgcg CRISPR spacer
ttttaaaattttaagcgcttgagaatttaa Protospacer
**************** ******* . .
35. spacer 4.9|1837259|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to KF751793 (Campylobacter phage CJIE4-1, complete genome) position: , mismatch: 7, identity: 0.767
ttttaaaattttaagcccttgagatacgcg CRISPR spacer
ttttaaaattttaagcgcttgagaatttaa Protospacer
**************** ******* . .
36. spacer 4.10|1837325|30|AP018676|CRT matches to NZ_CP016736 (Lactococcus lactis subsp. lactis strain UC06 plasmid pUC06C, complete sequence) position: , mismatch: 7, identity: 0.767
agctcctcttttgaagcattctcattttta CRISPR spacer
atctcctcttgtgaggcattctcattagcg Protospacer
* ******** ***.*********** ..
37. spacer 3.1|1358733|31|AP018676|CRISPRCasFinder,CRT matches to MN694364 (Marine virus AFVG_250M610, complete genome) position: , mismatch: 8, identity: 0.742
tggaatgtgacagaactgaaagaaatatcgg CRISPR spacer
aaatatgtgttagaactgaaagaaataacag Protospacer
.. ***** .**************** *.*
38. spacer 3.3|1358867|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP024036 (Bacillus aryabhattai strain K13 plasmid unnamed1) position: , mismatch: 8, identity: 0.733
gaatacgatatttatgattgatggcgctgg CRISPR spacer
aaatccgatatttatgatagatggggaatt Protospacer
.*** ************* ***** *
39. spacer 3.5|1358999|31|AP018676|CRISPRCasFinder,CRT matches to NZ_CP040341 (Bacillus cereus strain DLOU-Tangshan plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ccatatccttgtagagaaactctatcctttt CRISPR spacer
tcgataatttgtagagaaactcaatcctttt Protospacer
.*. .************** ********
40. spacer 3.5|1358999|31|AP018676|CRISPRCasFinder,CRT matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
ccatatccttgtagagaaactctatcctttt CRISPR spacer
tcgataatttgtagagaaactcaatcctttt Protospacer
.*. .************** ********
41. spacer 3.5|1358999|31|AP018676|CRISPRCasFinder,CRT matches to NZ_CP042928 (Bacillus cereus strain G1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
ccatatccttgtagagaaactctatcctttt CRISPR spacer
tcgataatttgtagagaaactcaatcctttt Protospacer
.*. .************** ********
42. spacer 3.12|1359466|30|AP018676|CRISPRCasFinder,CRT matches to KR063281 (Gordonia phage GMA2, complete genome) position: , mismatch: 8, identity: 0.733
cctcgctagacttgttagcgtcttttgctc CRISPR spacer
catcgctacccttgttagcgtctttctgct Protospacer
* ****** ***************. ..
43. spacer 3.19|1359930|30|AP018676|CRISPRCasFinder,CRT matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 8, identity: 0.733
cacttatttcaaaagaaaagcaatgcggac CRISPR spacer
gaagtatttcaaaagaaaatcaatgaaggt Protospacer
* *************** ***** .*..
44. spacer 3.20|1359996|30|AP018676|CRT matches to NZ_CP016747 (Lactococcus lactis subsp. cremoris strain JM1 plasmid pJM1A, complete sequence) position: , mismatch: 8, identity: 0.733
tgcctccagcattgttttcaaccttgccgg CRISPR spacer
gatctccagcattgtattcaaacttggcat Protospacer
..************ ***** **** *.
45. spacer 3.25|1360327|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 8, identity: 0.733
tcttgcattccgattccgctaagctccggg CRISPR spacer
ccgtgcatgccgattccgccaagctcgcct Protospacer
.* ***** **********.******
46. spacer 3.32|1360790|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP018790 (Campylobacter sp. RM6137 plasmid pSUIS6137, complete sequence) position: , mismatch: 8, identity: 0.733
tattgaatacacaagcataaaaggaaatat CRISPR spacer
agaaacatacataagcaaaaaaggaaatat Protospacer
. . *****.***** ************
47. spacer 3.37|1361120|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to AP014291 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S25-C40, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733
aaaaatccttttgtgcctacaatctttaaa CRISPR spacer
ttaggatcttttgtgcctacaatgtttaga Protospacer
*.. .**************** ****.*
48. spacer 3.44|1361582|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP027167 (Pseudomonas aeruginosa strain AR_0356 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733
aacttttgactcagggacaagctcaaagtt CRISPR spacer
agtgcatgactcagggccaagctcaacgta Protospacer
*.. . ********** ********* **
49. spacer 3.44|1361582|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP029091 (Pseudomonas aeruginosa strain AR441 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aacttttgactcagggacaagctcaaagtt CRISPR spacer
agtgcatgactcagggccaagctcaacgta Protospacer
*.. . ********** ********* **
50. spacer 3.44|1361582|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP052760 (Pseudomonas aeruginosa strain LYT4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
aacttttgactcagggacaagctcaaagtt CRISPR spacer
agtgcatgactcagggccaagctcaacgta Protospacer
*.. . ********** ********* **
51. spacer 3.44|1361582|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MN583270 (Pseudomonas aeruginosa strain NK546 plasmid pNK546b, complete sequence) position: , mismatch: 8, identity: 0.733
aacttttgactcagggacaagctcaaagtt CRISPR spacer
agtgcatgactcagggccaagctcaacgta Protospacer
*.. . ********** ********* **
52. spacer 3.48|1358734|31|AP018676|PILER-CR matches to MN694364 (Marine virus AFVG_250M610, complete genome) position: , mismatch: 8, identity: 0.742
tggaatgtgacagaactgaaagaaatatcgg CRISPR spacer
aaatatgtgttagaactgaaagaaataacag Protospacer
.. ***** .**************** *.*
53. spacer 3.50|1358868|30|AP018676|PILER-CR matches to NZ_CP024036 (Bacillus aryabhattai strain K13 plasmid unnamed1) position: , mismatch: 8, identity: 0.733
gaatacgatatttatgattgatggcgctgg CRISPR spacer
aaatccgatatttatgatagatggggaatt Protospacer
.*** ************* ***** *
54. spacer 3.52|1359000|31|AP018676|PILER-CR matches to NZ_CP040341 (Bacillus cereus strain DLOU-Tangshan plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
ccatatccttgtagagaaactctatcctttt CRISPR spacer
tcgataatttgtagagaaactcaatcctttt Protospacer
.*. .************** ********
55. spacer 3.52|1359000|31|AP018676|PILER-CR matches to NZ_CP053290 (Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
ccatatccttgtagagaaactctatcctttt CRISPR spacer
tcgataatttgtagagaaactcaatcctttt Protospacer
.*. .************** ********
56. spacer 3.52|1359000|31|AP018676|PILER-CR matches to NZ_CP042928 (Bacillus cereus strain G1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742
ccatatccttgtagagaaactctatcctttt CRISPR spacer
tcgataatttgtagagaaactcaatcctttt Protospacer
.*. .************** ********
57. spacer 4.1|1836731|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP007453 (Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence) position: , mismatch: 8, identity: 0.733
attgcaaataataatctcatcaatgctttg CRISPR spacer
gactttaataataatctcatcaatgattgg Protospacer
. . . ******************* ** *
58. spacer 4.1|1836731|30|AP018676|CRISPRCasFinder,CRT matches to MK448467 (Streptococcus satellite phage Javan391, complete genome) position: , mismatch: 8, identity: 0.733
attgcaa----ataataatctcatcaatgctttg CRISPR spacer
----tagctctataataatgtcatcaatgctgtg Protospacer
.*. ******** *********** **
59. spacer 4.1|1836731|30|AP018676|CRISPRCasFinder,CRT matches to MK448478 (Streptococcus satellite phage Javan409, complete genome) position: , mismatch: 8, identity: 0.733
attgcaa----ataataatctcatcaatgctttg CRISPR spacer
----tagctctataataatgtcatcaatgctgtg Protospacer
.*. ******** *********** **
60. spacer 4.1|1836731|30|AP018676|CRISPRCasFinder,CRT matches to MK448469 (Streptococcus satellite phage Javan396, complete genome) position: , mismatch: 8, identity: 0.733
attgcaa----ataataatctcatcaatgctttg CRISPR spacer
----tagctctataataatgtcatcaatgctgtg Protospacer
.*. ******** *********** **
61. spacer 4.2|1836797|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 8, identity: 0.733
tagcacaacatgcaaaagcgtaacaaatat CRISPR spacer
tagcacaacatgcaaaaccgaaatcgacgg Protospacer
***************** ** **. .*..
62. spacer 4.2|1836797|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.733
tagcacaacatgcaaaagcgtaacaaatat CRISPR spacer
tagcacaacatgcaaaaccgaaatcgacgg Protospacer
***************** ** **. .*..
63. spacer 4.3|1836863|30|AP018676|CRISPRCasFinder,CRT matches to NC_014633 (Ilyobacter polytropus DSM 2926 plasmid pILYOP01, complete sequence) position: , mismatch: 8, identity: 0.733
gcaagagtttcttttaaataaagatagtaa CRISPR spacer
taaagagttacttttaaataaaggcaaaga Protospacer
******* *************..*. .*
64. spacer 4.5|1836995|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to JX094431 (Bacillus cereus bacteriophage vB_BceM_Bc431v3, complete genome) position: , mismatch: 8, identity: 0.733
aactgcaaacttggaatctactatgcttta CRISPR spacer
gctaggtaacttggaatctactattctttt Protospacer
. . * ***************** ****
65. spacer 4.8|1837193|30|AP018676|CRISPRCasFinder,CRT,PILER-CR matches to KX119175 (Helicobacter phage Pt22899G, complete genome) position: , mismatch: 8, identity: 0.733
acttgcggacgagatttcatagaatctttg CRISPR spacer
aacagcggacgagatttcaaaaaatctcaa Protospacer
* . *************** *.*****. .
66. spacer 4.10|1837325|30|AP018676|CRT matches to MN692961 (Marine virus AFVG_117M41, complete genome) position: , mismatch: 8, identity: 0.733
agctcctcttttgaagcattctcattttta CRISPR spacer
gcagcttcttttaaagctttctcatttttt Protospacer
. *.******.**** ***********
67. spacer 3.19|1359930|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP022288 (Bacillus subtilis strain SX01705 plasmid pSX01705-1, complete sequence) position: , mismatch: 9, identity: 0.7
cacttatttcaaaagaaaagcaatgcggac CRISPR spacer
tacttatttgaaaagaaaaacaatctttgg Protospacer
.******** *********.**** . .
68. spacer 3.19|1359930|30|AP018676|CRISPRCasFinder,CRT matches to NZ_CP035229 (Bacillus licheniformis strain SRCM103529 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7
cacttatttcaaaagaaaagcaatgcggac CRISPR spacer
tacttatttgaaaagaaaaacaatctttgg Protospacer
.******** *********.**** . .
69. spacer 3.29|1360591|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to HQ634175 (Cyanophage P-RSM1 genomic sequence) position: , mismatch: 9, identity: 0.7
caacgagaaaacggaaacatcaaatgcctg CRISPR spacer
ttagaagaaaacggatacatcaaatgaaat Protospacer
. * .********** **********
70. spacer 3.47|1361780|30|AP018676|CRT,CRISPRCasFinder,PILER-CR matches to MG945715 (UNVERIFIED: Microviridae sp. isolate 1982-1801, complete genome) position: , mismatch: 9, identity: 0.7
ggaaatatactctttataagaaaaattttc CRISPR spacer
atgacctcactctttataaaaaaaattttg Protospacer
. .* . .***********.*********
71. spacer 1.1|147696|32|AP018676|PILER-CR matches to NC_014628 (Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence) position: , mismatch: 10, identity: 0.688
gccattgattgattctttggctcaaattcccc CRISPR spacer
aacattgattgatgctttgcctcaagtggatg Protospacer
. *********** ***** *****.* .
72. spacer 1.1|147696|32|AP018676|PILER-CR matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 10, identity: 0.688
gccattgattgattctttggctcaaattcccc CRISPR spacer
ttttgcgattgattcttaggttcaaattcttc Protospacer
.. .*********** **.********..*
73. spacer 2.1|540539|32|AP018676|PILER-CR matches to NC_014628 (Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence) position: , mismatch: 10, identity: 0.688
gccattgattgattctttggctcaaattcccc CRISPR spacer
aacattgattgatgctttgcctcaagtggatg Protospacer
. *********** ***** *****.* .
74. spacer 2.1|540539|32|AP018676|PILER-CR matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 10, identity: 0.688
gccattgattgattctttggctcaaattcccc CRISPR spacer
ttttgcgattgattcttaggttcaaattcttc Protospacer
.. .*********** **.********..*
