CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number	Prophage number	Anti-CRISPR protein number
CP029028	Candidatus Sulcia muelleri isolate SMMEIOSH chromosome, complete genome	1 crisprs	NA	3	1	0	0

Cas Category Instructions

Results visualization

1. CP029028

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP029028_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP029028_1

236530-236916

Orphan

Consensus_repeat	Method
ATTAAAAATTTTAAATAAATTGAAAAA	CRISPRCasFinder

7 spacers

The CRISPR arrays of CP029028_1

>merge|CP029028|1|236530-236916|CRISPRCasFinder
ATTAAAAATTTTTAATCAATTGAAAATAAAGGCTAATTTAGAGAAATTAAAAATTTTTAAGAAATTGAAAATAAATTATAATTTAGAGAAATTAAAAATTTTAAATAAATTGAAAAACTTTTCTTCTTTAGAATTAGAAGAATTATTAAAAATTTTTAATAAATTGAAAAAATATTTTAATTATTTTAATTTAGGGATTTTAAAAAATTTTAATAAATTTAAAAAATGTTCTCAGTTAGAGAGATTCAAAATTTTTAATCAATTGAAAAAAAGTTTTAATTTATCTAATATAAAAGAAACTAAATTAAATTAAAAAAAAATGTCAATTAAAAAAAAAAAACCGATTACTTCAAGTCAAAGATTCAAAATAATAAATTCATTTAAAGA

>CP029028|1|1|236530-236916|CRISPRCasFinder
ATTAAAAATTTTTAATCAATTGAAAAT	AAAGGCTAATTTAGAGAA
ATTAAAAATTTTTAAGAAATTGAAAAT	AAATTATAATTTAGAGAA
ATTAAAAATTTTAAATAAATTGAAAAA	CTTTTCTTCTTTAGAATTAGAAGAATT
ATTAAAAATTTTTAATAAATTGAAAAA	ATATTTTAATTATTTTAA
TTTAGGGATTTTAAAAAATTTTAATAA	ATTTAAAAAATGTTCTCAGTTAGAGAG
ATTCAAAATTTTTAATCAATTGAAAAA	AAGTTTTAATTTATCTAAT
ATAAAAGAAACTAAATTAAATTAAAAA	AAAATGTCAATTAAAAAAAAAAAACCGATTACTTCAAGTCAAAG
ATTCAAAATAATAAATTCATTTAAAGA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity
CP029028_1	1.1\|236557\|18\|CP029028\|CRISPRCasFinder	236557-236574	18	CP029028.1	178355-178372	2	0.889
CP029028_1	1.2\|236602\|18\|CP029028\|CRISPRCasFinder	236602-236619	18	CP029028.1	131405-131422	2	0.889
CP029028_1	1.4\|236701\|18\|CP029028\|CRISPRCasFinder	236701-236718	18	CP029028.1	11920-11937	2	0.889
CP029028_1	1.4\|236701\|18\|CP029028\|CRISPRCasFinder	236701-236718	18	CP029028.1	15245-15262	2	0.889
CP029028_1	1.4\|236701\|18\|CP029028\|CRISPRCasFinder	236701-236718	18	CP029028.1	40656-40673	2	0.889
CP029028_1	1.4\|236701\|18\|CP029028\|CRISPRCasFinder	236701-236718	18	CP029028.1	76870-76887	2	0.889
CP029028_1	1.4\|236701\|18\|CP029028\|CRISPRCasFinder	236701-236718	18	CP029028.1	115486-115503	2	0.889
CP029028_1	1.4\|236701\|18\|CP029028\|CRISPRCasFinder	236701-236718	18	CP029028.1	159155-159172	2	0.889
CP029028_1	1.4\|236701\|18\|CP029028\|CRISPRCasFinder	236701-236718	18	CP029028.1	188285-188302	2	0.889

1. spacer 1.1|236557|18|CP029028|CRISPRCasFinder matches to position: 178355-178372, mismatch: 2, identity: 0.889

aaaggctaatttagagaa	CRISPR spacer
aaaggataatttagaaaa	Protospacer
***** *********.**

2. spacer 1.2|236602|18|CP029028|CRISPRCasFinder matches to position: 131405-131422, mismatch: 2, identity: 0.889

aaattataatttagagaa	CRISPR spacer
aaattatattttagaaaa	Protospacer
******** ******.**

3. spacer 1.4|236701|18|CP029028|CRISPRCasFinder matches to position: 11920-11937, mismatch: 2, identity: 0.889

atattttaattattttaa	CRISPR spacer
atattttagtttttttaa	Protospacer
********.** ******

4. spacer 1.4|236701|18|CP029028|CRISPRCasFinder matches to position: 15245-15262, mismatch: 2, identity: 0.889

atattttaattattttaa	CRISPR spacer
attttttaaatattttaa	Protospacer
** ****** ********

5. spacer 1.4|236701|18|CP029028|CRISPRCasFinder matches to position: 40656-40673, mismatch: 2, identity: 0.889

atattttaattattttaa	CRISPR spacer
atatttaaattatttaaa	Protospacer
****** ******** **

6. spacer 1.4|236701|18|CP029028|CRISPRCasFinder matches to position: 76870-76887, mismatch: 2, identity: 0.889

atattttaattattttaa	CRISPR spacer
attttttaataattttaa	Protospacer
** ******* *******

7. spacer 1.4|236701|18|CP029028|CRISPRCasFinder matches to position: 115486-115503, mismatch: 2, identity: 0.889

atattttaattattttaa	CRISPR spacer
atattttattgattttaa	Protospacer
******** * *******

8. spacer 1.4|236701|18|CP029028|CRISPRCasFinder matches to position: 159155-159172, mismatch: 2, identity: 0.889

atattttaattattttaa	CRISPR spacer
atataataattattttaa	Protospacer
****  ************

9. spacer 1.4|236701|18|CP029028|CRISPRCasFinder matches to position: 188285-188302, mismatch: 2, identity: 0.889

atattttaattattttaa	CRISPR spacer
atatattatttattttaa	Protospacer
**** *** *********

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	MF001355	Proteus phage PM2, partial genome	4825-4851	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	KP890823	Proteus phage vB_PmiM_Pm5461, complete genome	18497-18523	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	KT264824	Gokushovirus WZ-2015a isolate 76Mky15, complete genome	2480-2506	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	NZ_CP013800	Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence	6589-6615	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	NZ_CP013819	Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence	16274-16300	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	NZ_CP013795	Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence	16274-16300	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	NC_013509	Edwardsiella tarda EIB202 plasmid pEIB202, complete sequence	20935-20961	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	MN694510	Marine virus AFVG_250M493, complete genome	27518-27544	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	KY593455	Yersinia phage fHe-Yen9-01, complete genome	112055-112081	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	NC_019909	Yersinia phage phiR1-RT complete genome	110966-110992	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	NC_028820	Yersinia phage vB_YenM_TG1, complete genome	102550-102576	5	0.815
CP029028_1	1.3\|236647\|27\|CP029028\|CRISPRCasFinder	236647-236673	27	NC_022603	Carnobacterium inhibens subsp. gilichinskyi plasmid pWNCR64, complete sequence	23486-23512	6	0.778

1. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to MF001355 (Proteus phage PM2, partial genome) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
atcatcttctttagaattagaagagtg	Protospacer
 *. ********************.*

2. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to KP890823 (Proteus phage vB_PmiM_Pm5461, complete genome) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
atcatcttctttagaattagaagagtg	Protospacer
 *. ********************.*

3. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to KT264824 (Gokushovirus WZ-2015a isolate 76Mky15, complete genome) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
cttttcttctttagaattaaaaacctg	Protospacer
*******************.**.  *

4. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to NZ_CP013800 (Piscirickettsia salmonis strain AY6532B plasmid p4PS9, complete sequence) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
cgtttcttctttagaatcagaaaaacc	Protospacer
* ***************.****.**..

5. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to NZ_CP013819 (Piscirickettsia salmonis strain AY3800B plasmid p3PS10, complete sequence) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
cgtttcttctttagaatcagaaaaacc	Protospacer
* ***************.****.**..

6. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to NZ_CP013795 (Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
cgtttcttctttagaatcagaaaaacc	Protospacer
* ***************.****.**..

7. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to NC_013509 (Edwardsiella tarda EIB202 plasmid pEIB202, complete sequence) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
cgtttcttctttagaatcagaaaaacc	Protospacer
* ***************.****.**..

8. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to MN694510 (Marine virus AFVG_250M493, complete genome) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
tatttcttctttagaattaaacgaact	Protospacer
. *****************.* ***.*

9. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to KY593455 (Yersinia phage fHe-Yen9-01, complete genome) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
atcttcttctttagaaccagaagaatg	Protospacer
 *.*************..********

10. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to NC_019909 (Yersinia phage phiR1-RT complete genome) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
atcttcttctttagaaccagaagaatg	Protospacer
 *.*************..********

11. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to NC_028820 (Yersinia phage vB_YenM_TG1, complete genome) position: , mismatch: 5, identity: 0.815

cttttcttctttagaattagaagaatt	CRISPR spacer
atcttcttctttagaaccagaagaatg	Protospacer
 *.*************..********

12. spacer 1.3|236647|27|CP029028|CRISPRCasFinder matches to NC_022603 (Carnobacterium inhibens subsp. gilichinskyi plasmid pWNCR64, complete sequence) position: , mismatch: 6, identity: 0.778

cttttcttctttagaattagaagaatt	CRISPR spacer
cttttcttctttagaactagattgacc	Protospacer
****************.****  .*..

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage