1. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 4, identity: 0.871         
            
-accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gatcggc-aggccggccagcagtacggcaacc	Protospacer
 *.** * ********************.***
          
      
            
              2. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 6, identity: 0.806         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cacgccgaggccggccagcagggcggcgccg	Protospacer
  ******************* .***** * 
          
      
            
              3. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.806         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cacgccgaggccggccagcagggcggcgccg	Protospacer
  ******************* .***** * 
          
      
            
              4. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 6, identity: 0.824         
            
-ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ccgcgtc-gccgccagcgccgggtcgccggcgacc	Protospacer
 . **** ******** ******** ******** 
          
      
            
              5. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 7, identity: 0.774         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcggagaggccggccagccgtgcggcgaac	Protospacer
  **  ************* **.****** *
          
      
            
              6. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 7, identity: 0.774         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
accgtcgaggccggccagctgtagcgccgct	Protospacer
****.************** ***  ** .*.
          
      
            
              7. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP024891 (Rhodococcus ruber strain YYL plasmid pYYL1.2, complete sequence) position: , mismatch: 7, identity: 0.774         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
accgtcgaggccggccagctgtagcgccgct	Protospacer
****.************** ***  ** .*.
          
      
            
              8. spacer 5.2|3839758|31|CP029843|CRISPRCasFinder matches to NZ_CP016620 (Microvirga ossetica strain V5/3m plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.774         
            
cggatccacgagaacgcccgggtccgcgatg	CRISPR spacer
ggcaagcccgtgaacgcccgggtcggcgatg	Protospacer
 * *  * ** ************* ******
          
      
            
              9. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ttcgtcggcagccagggccgcgtcgtcgaggccg	Protospacer
********* ********** *** .**. * **
          
      
            
              10. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.794         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ttcgtcggcagccagggccgcgtcgtcgaggccg	Protospacer
********* ********** *** .**. * **
          
      
            
              11. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 7, identity: 0.794         
            
-ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ccgcgtctg-cgccagcgccgggtcgccggcgacc	Protospacer
 . **** * ****** ******** ******** 
          
      
            
              12. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ttcgtcggcagccagggccgcgtcgtcgaggccg	Protospacer
********* ********** *** .**. * **
          
      
            
              13. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.794         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ttcgtcggcagccagggccgcgtcgtcgaggccg	Protospacer
********* ********** *** .**. * **
          
      
            
              14. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 7, identity: 0.794         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ttcgtcggcagccagggccgcgtcgtcgaggccg	Protospacer
********* ********** *** .**. * **
          
      
            
              15. spacer 5.6|3839704|36|CP029843|CRT matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 7, identity: 0.806         
            
-accgccgaggccggccagcagtacggcgacctggag	CRISPR spacer
gatcggc-aggccggccagcagtacggcaacccgggc	Protospacer
 *.** * ********************.***.**. 
          
      
            
              16. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cggggcgagaccggccagcaggacggcgagg	Protospacer
   * ****.*********** *******  
          
      
            
              17. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gttgaagagcccggccagcagcacggcgacg	Protospacer
...*  *** ***********.******** 
          
      
            
              18. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cggggcgagaccggccagcaggacggcgagg	Protospacer
   * ****.*********** *******  
          
      
            
              19. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
tacgccgagaccggcctgcagtacgggcccg	Protospacer
  *******.****** *********   * 
          
      
            
              20. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cggggcgagaccggccagcaggacggcgagg	Protospacer
   * ****.*********** *******  
          
      
            
              21. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cggggcgagaccggccagcaggacggcgagg	Protospacer
   * ****.*********** *******  
          
      
            
              22. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
tgttccgaggccggcgagcagtaaggcgggc	Protospacer
  . *********** ******* ****. *
          
      
            
              23. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NC_013513 (Paracoccus aminophilus strain JCM 7686 plasmid pAMI3, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
ggcatcgaggtcggccagcagtccggcgatt	Protospacer
. *..*****.*********** ******..
          
      
            
              24. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP011667 (Streptomyces sp. Mg1 plasmid pSMg1-3, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gtcctccaggccggccagcagggcggcgacg	Protospacer
..* .* ************** .******* 
          
      
            
              25. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP015043 (Rhodovulum sp. P5 plasmid pRGUI04, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gatgtcgaggccggcccgcaggacggcggct	Protospacer
. .*.*********** **** ******.*.
          
      
            
              26. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to MG962366 (Rhodococcus phage Finch, complete genome) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gtcaccgaggacggcgagcagtacggcttca	Protospacer
..*.****** **** ***********  * 
          
      
            
              27. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
aaaatcgcggccggccagcagtccggcggca	Protospacer
*  ..** ************** *****.* 
          
      
            
              28. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP007516 (Rubrobacter radiotolerans strain RSPS-4 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gccttcgaggccggccagcgggacggcgtga	Protospacer
.** .**************.* ******   
          
      
            
              29. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP033583 (Streptomyces sp. ADI95-16 plasmid pADI95-16b, complete sequence) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gtcctccaggccggccagcagggcggcgacg	Protospacer
..* .* ************** .******* 
          
      
            
              30. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to MH834603 (Arthrobacter phage Bridgette, complete genome) position: , mismatch: 8, identity: 0.742         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
gatgccgaggcccgcctgcagtacgggttcc	Protospacer
. .********* *** *********   **
          
      
            
              31. spacer 5.2|3839758|31|CP029843|CRISPRCasFinder matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 8, identity: 0.742         
            
cggatccacgagaacgcccgggtccgcgatg	CRISPR spacer
gcgatccacgacaacgcccggatcccggcgg	Protospacer
  ********* *********.***  *  *
          
      
            
              32. spacer 5.2|3839758|31|CP029843|CRISPRCasFinder matches to NZ_CP018075 (Streptomyces venezuelae strain NRRL B-65442 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742         
            
cggatccacgagaacgcccgggtccgcgatg	CRISPR spacer
gcgatccacgacaacgcccggatcccggcag	Protospacer
  ********* *********.***  *  *
          
      
            
              33. spacer 5.2|3839758|31|CP029843|CRISPRCasFinder matches to NC_010851 (Streptomyces sp. FR1 plasmid pFRL1, complete sequence) position: , mismatch: 8, identity: 0.742         
            
cggatccacgagaacgcccgggtccgcgatg	CRISPR spacer
gcgatccacgacaacgcccggatcccggcgg	Protospacer
  ********* *********.***  *  *
          
      
            
              34. spacer 5.3|3839812|31|CP029843|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742         
            
aaggtcgccgcgtcggcgcataccggcgctc	CRISPR spacer
gagacggccgccacggcgcataccggcgcga	Protospacer
.**.. *****  ****************  
          
      
            
              35. spacer 5.4|3839866|34|CP029843|CRISPRCasFinder matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.765         
            
cgcctggaagagacggtgaccgtcgacggcagca	CRISPR spacer
cggaccggcgagacggtgcccggcgacggcagca	Protospacer
**  . *. ********* *** ***********
          
      
            
              36. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
gacatgggcggccagggccgggtctgcggcgatc	Protospacer
  *.* *** *************** ******. 
          
      
            
              37. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.765         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
attgttctccgccagcgccgggtctgcggcgagg	Protospacer
 *.**.  ******* ********* ****** *
          
      
            
              38. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcgcccaggccggccagcagttcgaggttg	Protospacer
  **** *************** **. * . 
          
      
            
              39. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcgcccaggccggccagcagttcgaggttg	Protospacer
  **** *************** **. * . 
          
      
            
              40. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcgcccaggccggccagcagttcgaggttg	Protospacer
  **** *************** **. * . 
          
      
            
              41. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcgcccaggccggccagcagttcgaggttg	Protospacer
  **** *************** **. * . 
          
      
            
              42. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcgcccaggccggccagcagttcgaggttg	Protospacer
  **** *************** **. * . 
          
      
            
              43. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
ctgaacgaggccggcctgcaggacggcgccg	Protospacer
 . . *********** **** ****** * 
          
      
            
              44. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcgcccaggccggccagcagttcgaggttg	Protospacer
  **** *************** **. * . 
          
      
            
              45. spacer 5.1|3839704|31|CP029843|CRISPRCasFinder matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 9, identity: 0.71         
            
accgccgaggccggccagcagtacggcgacc	CRISPR spacer
cgcgccgagaccggccagcagtgcgcccgga	Protospacer
  *******.************.** * .  
          
      
            
              46. spacer 5.3|3839812|31|CP029843|CRISPRCasFinder matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 9, identity: 0.71         
            
aaggtcgccgcgtcggcgcataccggcgctc	CRISPR spacer
acccccgccgcgccggcgcctaccggcgtgg	Protospacer
*   .*******.****** ********.  
          
      
            
              47. spacer 5.5|3839923|34|CP029843|CRISPRCasFinder matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 9, identity: 0.735         
            
ttcgtcggccgccagggccgggtctccggcgacg	CRISPR spacer
ttcgtcagccgtcagggccgggtcggccggaaga	Protospacer
******.****.************  * * .* .
          
      
            
              48. spacer 5.3|3839812|31|CP029843|CRISPRCasFinder matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 10, identity: 0.677         
            
aaggtcgccgcgtcggcgcataccggcgctc	CRISPR spacer
ggcatcgccgcggccgcgcataccggcagca	Protospacer
.. .******** * ************. . 
          
      
            
              49. spacer 5.4|3839866|34|CP029843|CRISPRCasFinder matches to NZ_LR026982 (Rhodoplanes piscinae isolate Rhod_plasmid plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.706         
            
-----cgcctggaagagacggtgaccgtcgacggcagca	CRISPR spacer
atgaccctccagaa-----ggtgaccgtcgacggcatca	Protospacer
     * .*..***     ***************** **
          
      
            
              50. spacer 5.6|3839704|36|CP029843|CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 10, identity: 0.722         
            
accgccgaggccggccagcagtacggcgacctggag	CRISPR spacer
cacgccgaggccggccagcagggcggcgccgaacgg	Protospacer
  ******************* .***** *  . .*
          
      
            
              51. spacer 5.6|3839704|36|CP029843|CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 10, identity: 0.722         
            
accgccgaggccggccagcagtacggcgacctggag	CRISPR spacer
cacgccgaggccggccagcagggcggcgccgaacgg	Protospacer
  ******************* .***** *  . .*