1. spacer 1.1|1769751|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 0, identity: 1.0
ttgagccagtttttagttacgccaatccaccg CRISPR spacer
ttgagccagtttttagttacgccaatccaccg Protospacer
********************************
2. spacer 1.6|1770051|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 0, identity: 1.0
cacctgatgcgaaggtacgggacatcgataac CRISPR spacer
cacctgatgcgaaggtacgggacatcgataac Protospacer
********************************
3. spacer 1.16|1770651|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 0, identity: 1.0
tgcattgtgctttcgctcatctgtaaaaattc CRISPR spacer
tgcattgtgctttcgctcatctgtaaaaattc Protospacer
********************************
4. spacer 1.30|1771494|32|CP030031|PILER-CR matches to MF417929 (Uncultured Caudovirales phage clone 2F_1, partial genome) position: , mismatch: 0, identity: 1.0
agtagatgcgaaatcttatgcagcacgttgga CRISPR spacer
agtagatgcgaaatcttatgcagcacgttgga Protospacer
********************************
5. spacer 1.38|1771491|32|CP030031|CRISPRCasFinder,CRT matches to MF417929 (Uncultured Caudovirales phage clone 2F_1, partial genome) position: , mismatch: 0, identity: 1.0
agtagatgcgaaatcttatgcagcacgttgga CRISPR spacer
agtagatgcgaaatcttatgcagcacgttgga Protospacer
********************************
6. spacer 1.2|1769811|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MN694754 (Marine virus AFVG_250M450, complete genome) position: , mismatch: 1, identity: 0.969
caccccatcagccactcgacccaatcggggtt CRISPR spacer
caccccattagccactcgacccaatcggggtt Protospacer
********.***********************
7. spacer 1.27|1771314|32|CP030031|PILER-CR matches to MF417906 (Uncultured Caudovirales phage clone 7F_8, partial genome) position: , mismatch: 1, identity: 0.969
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ctcatgctctggtaaatcttctgccagcaccc Protospacer
.*******************************
8. spacer 1.27|1771314|32|CP030031|PILER-CR matches to MF417894 (Uncultured Caudovirales phage clone 7AX_4, partial genome) position: , mismatch: 1, identity: 0.969
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ctcatgctctggtaaatcttctgccagcaccc Protospacer
.*******************************
9. spacer 1.27|1771314|32|CP030031|PILER-CR matches to MF417905 (Uncultured Caudovirales phage clone 8AX_11, partial genome) position: , mismatch: 1, identity: 0.969
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ctcatgctctggtaaatcttctgccagcaccc Protospacer
.*******************************
10. spacer 1.29|1771434|32|CP030031|PILER-CR matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 1, identity: 0.969
caaagcatcacgaagtaggctgatccgagcag CRISPR spacer
caaagcatcacgaagtaggctgatctgagcag Protospacer
*************************.******
11. spacer 1.35|1771311|32|CP030031|CRISPRCasFinder,CRT matches to MF417906 (Uncultured Caudovirales phage clone 7F_8, partial genome) position: , mismatch: 1, identity: 0.969
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ctcatgctctggtaaatcttctgccagcaccc Protospacer
.*******************************
12. spacer 1.35|1771311|32|CP030031|CRISPRCasFinder,CRT matches to MF417894 (Uncultured Caudovirales phage clone 7AX_4, partial genome) position: , mismatch: 1, identity: 0.969
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ctcatgctctggtaaatcttctgccagcaccc Protospacer
.*******************************
13. spacer 1.35|1771311|32|CP030031|CRISPRCasFinder,CRT matches to MF417905 (Uncultured Caudovirales phage clone 8AX_11, partial genome) position: , mismatch: 1, identity: 0.969
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ctcatgctctggtaaatcttctgccagcaccc Protospacer
.*******************************
14. spacer 1.37|1771431|32|CP030031|CRISPRCasFinder,CRT matches to MF417892 (Uncultured Caudovirales phage clone 2F_2, partial genome) position: , mismatch: 1, identity: 0.969
caaagcatcacgaagtaggctgatccgagcag CRISPR spacer
caaagcatcacgaagtaggctgatctgagcag Protospacer
*************************.******
15. spacer 1.2|1769811|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MN693946 (Marine virus AFVG_250M886, complete genome) position: , mismatch: 4, identity: 0.875
caccccatcagccactcgacccaatcggggtt CRISPR spacer
tatcccatcagccactcgacccactccgggtt Protospacer
.*.******************** ** *****
16. spacer 1.10|1770291|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 6, identity: 0.812
tgattccgg--gcacgttcttcagcgacctgaaa CRISPR spacer
--tttccgaacgcacggtcttcaacgacctgaaa Protospacer
*****. ***** ******.**********
17. spacer 1.11|1770351|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 6, identity: 0.812
tgattccgg--gcacgttcttcagcgacctgaaa CRISPR spacer
--tttccgaacgcacggtcttcaacgacctgaaa Protospacer
*****. ***** ******.**********
18. spacer 1.8|1770171|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026690 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM8, complete sequence) position: , mismatch: 7, identity: 0.781
aaactgttcttgcagctcagcaaacgtataga CRISPR spacer
taactgttcttgtagttcagcaaaggcgttga Protospacer
***********.**.******** *..* **
19. spacer 1.20|1770891|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013615 (Clostridium perfringens strain JP838 plasmid pJFP838A, complete sequence) position: , mismatch: 7, identity: 0.781
actgtatttgagtattcaatttttttaccttt CRISPR spacer
tctatttgagagtatgtaatttttttaccttt Protospacer
**.* * ****** .***************
20. spacer 1.27|1771314|32|CP030031|PILER-CR matches to AP018319 (Nostoc sp. HK-01 plasmid plasmid1 DNA, complete genome) position: , mismatch: 7, identity: 0.781
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
gttaaactctggtaaatctactgccagcccca Protospacer
*.* .************* ******** **
21. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_KX129784 (Escherichia coli strain H226B plasmid pH226B, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
22. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_KM670336 (Salmonella enterica subsp. enterica serovar Senftenberg strain SRC119 plasmid pSRC119-A/C, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
23. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP042339 (Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_A, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
24. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
25. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP053739 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncR, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
26. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
27. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP042646 (Escherichia coli strain NCYU-21-79 plasmid pNCYU-21-79-1, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
28. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP044300 (Escherichia coli strain P59A plasmid pP59A-2, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
29. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP044302 (Escherichia coli strain P59A plasmid pP59A-4, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
30. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
31. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to AP020333 (Salmonella enterica SESen3709 plasmid pSESen3709_1 DNA, complete genome) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
32. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
33. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP041102 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
34. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP042610 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-4, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
35. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
36. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to CP052193 (Klebsiella pneumoniae strain F16KP0014 plasmid pF16KP0014-1, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
37. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to MN824001 (Klebsiella pneumoniae strain N201205880 plasmid p205880-1FIIK, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
38. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP026418 (Acinetobacter sp. ACNIH2 plasmid pKPC-8dee, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
39. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP035198 (Klebsiella pneumoniae strain LH375 plasmid pLH375-2_incR, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
40. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP035200 (Klebsiella pneumoniae strain LH375 plasmid pLH375-3, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
41. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP035213 (Klebsiella pneumoniae strain TH164 plasmid pTH164-3, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
42. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
43. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP037904 (Escherichia coli strain LHM10-1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
44. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
45. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
46. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_MK770642 (Klebsiella pneumoniae strain T38 plasmid pT38_MCR3, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
47. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_AP018939 (Escherichia coli strain JSWP006 plasmid pJSWP006_1, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
48. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_MH341574 (Klebsiella pneumoniae strain MYKLB95 plasmid MYKLB95-1, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
49. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
50. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
51. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_MF627445 (Vibrio parahaemolyticus strain Vb0499 plasmid pVb0499, complete sequence) position: , mismatch: 7, identity: 0.781
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
ggcagttgcgccagtaccatcagcagacccag Protospacer
* ******** ***** ********* ..**.
52. spacer 1.35|1771311|32|CP030031|CRISPRCasFinder,CRT matches to AP018319 (Nostoc sp. HK-01 plasmid plasmid1 DNA, complete genome) position: , mismatch: 7, identity: 0.781
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
gttaaactctggtaaatctactgccagcccca Protospacer
*.* .************* ******** **
53. spacer 1.3|1769871|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MG592567 (Vibrio phage 1.198.A._10N.286.54.F4, partial genome) position: , mismatch: 8, identity: 0.75
ttttgatatcaaaggaaaggtttacaagatag CRISPR spacer
cgatgaaaacaaaggaaaggtttacaccagag Protospacer
. *** * ***************** * **
54. spacer 1.3|1769871|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MG592568 (Vibrio phage 1.198.B._10N.286.54.F4, partial genome) position: , mismatch: 8, identity: 0.75
ttttgatatcaaaggaaaggtttacaagatag CRISPR spacer
cgatgaaaacaaaggaaaggtttacaccagag Protospacer
. *** * ***************** * **
55. spacer 1.3|1769871|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MG592434 (Vibrio phage 1.054.O._10N.261.52.A1, partial genome) position: , mismatch: 8, identity: 0.75
ttttgatatcaaaggaaaggtttacaagatag CRISPR spacer
cgatgaaaacaaaggaaaggtttacacgcaag Protospacer
. *** * ***************** * **
56. spacer 1.12|1770411|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
aaagatgtgagcttctgctgctgttgttgtgg CRISPR spacer
gtcgatgtaagcttctcctgctgttgtcttga Protospacer
. *****.******* **********. **.
57. spacer 1.20|1770891|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021661 (Candidatus Fukatsuia symbiotica strain 5D plasmid p5D_Fsymbiotica-2) position: , mismatch: 8, identity: 0.75
actgtatttgagtattcaatttttttaccttt CRISPR spacer
atagggattgagtattcattttttctacctta Protospacer
*. * . *********** *****.******
58. spacer 1.32|1771614|32|CP030031|PILER-CR matches to AP014349 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C79, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
attcggattcttggcaaggttttgtaaatgac CRISPR spacer
aataaaaatcttgataaggttttgtaaatgat Protospacer
* * ..* *****..****************.
59. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
--gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
gcgctggc--gggcagtaacagcagcagctacaa Protospacer
**..*. ********** ******** ***
60. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 8, identity: 0.75
--gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
gcgctggc--gggcagtaacagcagcagctacaa Protospacer
**..*. ********** ******** ***
61. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP038855 (Pantoea vagans strain LMG 24199 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
--gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
gcgctggc--gggcagtaacagcagcagctacaa Protospacer
**..*. ********** ******** ***
62. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75
--gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
gcgctggc--gggcagtaacagcagcagctacaa Protospacer
**..*. ********** ******** ***
63. spacer 1.40|1771611|32|CP030031|CRISPRCasFinder,CRT matches to AP014349 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S38-C79, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
attcggattcttggcaaggttttgtaaatgac CRISPR spacer
aataaaaatcttgataaggttttgtaaatgat Protospacer
* * ..* *****..****************.
64. spacer 1.41|1771671|32|CP030031|CRISPRCasFinder,CRT matches to MK813939 (Aeromonas phage 4_L372D, complete genome) position: , mismatch: 8, identity: 0.75
-tcaccgtttttagtgtcagtaacggtaatagt CRISPR spacer
gtca-agtttttagtctcagtaactgtaacttc Protospacer
*** ********* ******** ****. .
65. spacer 1.41|1771671|32|CP030031|CRISPRCasFinder,CRT matches to MK804893 (Aeromonas phage 2-L372D, complete genome) position: , mismatch: 8, identity: 0.75
-tcaccgtttttagtgtcagtaacggtaatagt CRISPR spacer
gtca-agtttttagtctcagtaactgtaacttc Protospacer
*** ********* ******** ****. .
66. spacer 1.41|1771671|32|CP030031|CRISPRCasFinder,CRT matches to NC_048770 (Aeromonas phage 2_L372X, complete genome) position: , mismatch: 8, identity: 0.75
-tcaccgtttttagtgtcagtaacggtaatagt CRISPR spacer
gtca-agtttttagtctcagtaactgtaacttc Protospacer
*** ********* ******** ****. .
67. spacer 1.41|1771671|32|CP030031|CRISPRCasFinder,CRT matches to MK813941 (Aeromonas phage 4_L372XY, complete genome) position: , mismatch: 8, identity: 0.75
-tcaccgtttttagtgtcagtaacggtaatagt CRISPR spacer
gtca-agtttttagtctcagtaactgtaacttc Protospacer
*** ********* ******** ****. .
68. spacer 1.1|1769751|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MN694268 (Marine virus AFVG_250M110, complete genome) position: , mismatch: 9, identity: 0.719
ttgagccagtttttagttacgccaatccaccg CRISPR spacer
attgaccagttcttacttacgccaatccgact Protospacer
* ..******.*** ************. *
69. spacer 1.2|1769811|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
caccccatcagccactcgacccaatcggggtt CRISPR spacer
tccatgatcagcccctcgacccagtcgggatc Protospacer
. * . ******* *********.*****.*.
70. spacer 1.2|1769811|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005086 (Sphingobium sp. TKS plasmid pTK2, complete sequence) position: , mismatch: 9, identity: 0.719
caccccatcagccactcgacccaatcggggtt CRISPR spacer
aatgccaacagccacgcgacccaatcgccaat Protospacer
*. *** ******* *********** . *
71. spacer 1.7|1770111|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
ttctaccggtggtccttctactggtgacggtg CRISPR spacer
gccagtcggtggtgcttcaactggtgacgacg Protospacer
.* ..******* **** **********..*
72. spacer 1.7|1770111|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP018665 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_2, complete sequence) position: , mismatch: 9, identity: 0.719
ttctaccggtggtccttctactggtgacggtg CRISPR spacer
gccagtcggtggtgcttcaactggtgacgacg Protospacer
.* ..******* **** **********..*
73. spacer 1.7|1770111|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018821 (Sphingomonas koreensis strain ABOJV plasmid tig00000001, complete sequence) position: , mismatch: 9, identity: 0.719
ttctaccggtggtccttctactggtgacggtg CRISPR spacer
gccagtcggtggtgcttcaactggtgacgacg Protospacer
.* ..******* **** **********..*
74. spacer 1.7|1770111|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to CP021185 (Sphingomonas wittichii DC-6 plasmid pDC04, complete sequence) position: , mismatch: 9, identity: 0.719
ttctaccggtggtccttctactggtgacggtg CRISPR spacer
gccagtcggtggtgcttcaactggtgacgacg Protospacer
.* ..******* **** **********..*
75. spacer 1.24|1771131|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017256 (Clostridium taeniosporum strain 1/k plasmid pCt3, complete sequence) position: , mismatch: 9, identity: 0.719
tccatccggttatccctcttattattatttta CRISPR spacer
taatactttttattcctcttattatgatttta Protospacer
* *. ****.*********** ******
76. spacer 1.32|1771614|32|CP030031|PILER-CR matches to MN693545 (Marine virus AFVG_25M554, complete genome) position: , mismatch: 9, identity: 0.719
attcggattcttggcaaggttttgtaaatgac CRISPR spacer
gataatagtcttgataaggttttgtaaatgaa Protospacer
. * . * *****..****************
77. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to NC_013636 (Pseudoalteromonas sp. BSi20327 plasmid pSM327, complete sequence) position: , mismatch: 9, identity: 0.719
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
agtagttgcagcagtaacttcagcagcagctt Protospacer
. .******.******** ******** *
78. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to MH572328 (Microviridae sp. isolate SD_SC_107, complete genome) position: , mismatch: 9, identity: 0.719
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
agcagttgcagcagtaagatcagcatatacgc Protospacer
. *******.******* ******* * *.
79. spacer 1.40|1771611|32|CP030031|CRISPRCasFinder,CRT matches to MN693545 (Marine virus AFVG_25M554, complete genome) position: , mismatch: 9, identity: 0.719
attcggattcttggcaaggttttgtaaatgac CRISPR spacer
gataatagtcttgataaggttttgtaaatgaa Protospacer
. * . * *****..****************
80. spacer 1.4|1769931|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NC_011422 (Salmonella enterica subsp. enterica serovar Typhi str. 404ty plasmid pBSSB1, complete sequence) position: , mismatch: 10, identity: 0.688
aataaataataagcgtgccagtgggagtaatt CRISPR spacer
gataaataataacagtgccagtggtgcaggtg Protospacer
.*********** ********** . ..*
81. spacer 1.4|1769931|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038605 (Salmonella enterica subsp. enterica serovar Senftenberg strain CFIAFB20170120 plasmid pGTAFD2016-MI-0253.1, complete sequence) position: , mismatch: 10, identity: 0.688
aataaataataagcgtgccagtgggagtaatt CRISPR spacer
gataaataataacagtgccagtggtgcaggtg Protospacer
.*********** ********** . ..*
82. spacer 1.4|1769931|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026380 (Salmonella enterica subsp. enterica serovar Senftenberg strain N17 plasmid pN17-509) position: , mismatch: 10, identity: 0.688
aataaataataagcgtgccagtgggagtaatt CRISPR spacer
gataaataataacagtgccagtggtgcaggtg Protospacer
.*********** ********** . ..*
83. spacer 1.4|1769931|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038592 (Salmonella enterica subsp. enterica serovar Senftenberg strain SA20061017 plasmid pSA20061017, complete sequence) position: , mismatch: 10, identity: 0.688
aataaataataagcgtgccagtgggagtaatt CRISPR spacer
gataaataataacagtgccagtggtgcaggtg Protospacer
.*********** ********** . ..*
84. spacer 1.4|1769931|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038594 (Salmonella enterica subsp. enterica serovar Senftenberg strain SA20130280 plasmid pSA20130280.1, complete sequence) position: , mismatch: 10, identity: 0.688
aataaataataagcgtgccagtgggagtaatt CRISPR spacer
gataaataataacagtgccagtggtgcaggtg Protospacer
.*********** ********** . ..*
85. spacer 1.27|1771314|32|CP030031|PILER-CR matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 10, identity: 0.688
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ttcaagctctggtaaatcttttgtatttaaat Protospacer
**** ***************.**. .* .
86. spacer 1.30|1771494|32|CP030031|PILER-CR matches to MH598803 (Pelagibacter phage HTVC121P, complete genome) position: , mismatch: 10, identity: 0.688
agtagatgcgaaatcttatgcagcacgttgga CRISPR spacer
gttagatgcaaaatcttatgaagcattagaaa Protospacer
. *******.********** ****. ..*
87. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to MK448721 (Streptococcus phage Javan263, complete genome) position: , mismatch: 10, identity: 0.688
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
atagaactcggcagtaacatcagcacgttcaa Protospacer
.. .. . ***************** *****
88. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to AP013438 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C113A-MedDCM-OCT-S35-C17) position: , mismatch: 10, identity: 0.688
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
attagttgcatcagtaacatcagcagatgttt Protospacer
...******. *************** * .
89. spacer 1.33|1771191|32|CP030031|CRISPRCasFinder,CRT matches to AP013702 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C113A-MedDCM-OCT-S33-C15, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.688
gccagttgcggcagtaacatcagcagcttcaa CRISPR spacer
attagttgcatcagtaacatcagcagatgttt Protospacer
...******. *************** * .
90. spacer 1.35|1771311|32|CP030031|CRISPRCasFinder,CRT matches to NC_014534 (Gloeothece verrucosa PCC 7822 plasmid Cy782202, complete sequence) position: , mismatch: 10, identity: 0.688
ttcatgctctggtaaatcttctgccagcaccc CRISPR spacer
ttcaagctctggtaaatcttttgtatttaaat Protospacer
**** ***************.**. .* .
91. spacer 1.38|1771491|32|CP030031|CRISPRCasFinder,CRT matches to MH598803 (Pelagibacter phage HTVC121P, complete genome) position: , mismatch: 10, identity: 0.688
agtagatgcgaaatcttatgcagcacgttgga CRISPR spacer
gttagatgcaaaatcttatgaagcattagaaa Protospacer
. *******.********** ****. ..*
92. spacer 1.42|1771731|32|CP030031|CRISPRCasFinder matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
tatcccttatctttcggcttgtcatctatgaa CRISPR spacer
atctccttacatttcggcttgtcatcttgaag Protospacer
..*****. **************** .*.
93. spacer 1.1|1769751|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MK249208 (Blackfly microvirus SF02 isolate 156, complete genome) position: , mismatch: 11, identity: 0.656
ttgagccagtttttagttacgccaatccaccg CRISPR spacer
ttgagccagtgtttaggtacgccctgttgata Protospacer
********** ***** ****** ... ..
94. spacer 1.7|1770111|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to MN693673 (Marine virus AFVG_250M950, complete genome) position: , mismatch: 11, identity: 0.656
ttctaccggtggtccttctactggtgacggtg CRISPR spacer
gtcttccggtgttccttctactggaactaaga Protospacer
*** ****** ************ . ... .
95. spacer 1.20|1770891|32|CP030031|PILER-CR,CRISPRCasFinder,CRT matches to AP014307 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S29-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 11, identity: 0.656
actgtatttgagtattcaatttttttaccttt CRISPR spacer
ctcaatcttgattattcaatttatttacctag Protospacer
... .**** ********** *******
96. spacer 1.26|1771254|32|CP030031|PILER-CR matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
97. spacer 1.26|1771254|32|CP030031|PILER-CR matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
98. spacer 1.26|1771254|32|CP030031|PILER-CR matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
99. spacer 1.26|1771254|32|CP030031|PILER-CR matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
100. spacer 1.34|1771251|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP020426 (Clostridioides difficile strain FDAARGOS_267 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
101. spacer 1.34|1771251|32|CP030031|CRISPRCasFinder,CRT matches to NZ_CP029155 (Clostridioides difficile strain CD161 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
102. spacer 1.34|1771251|32|CP030031|CRISPRCasFinder,CRT matches to CP011970 (Peptoclostridium phage phiCDIF1296T strain DSM 1296, complete sequence) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
103. spacer 1.34|1771251|32|CP030031|CRISPRCasFinder,CRT matches to LN681537 (Clostridium phage phiCD211, complete genome) position: , mismatch: 11, identity: 0.656
gataagagtcaattaacaatttcttatcatca CRISPR spacer
atcctttttccattaataatttcttatcatct Protospacer
. . ** *****.**************
