1. spacer 3.1|2296320|32|CP029712|CRISPRCasFinder matches to NC_008193 (Pasteurella phage F108, complete genome) position: , mismatch: 0, identity: 1.0
ggatcgatgattgctagcaagtaatctttgat CRISPR spacer
ggatcgatgattgctagcaagtaatctttgat Protospacer
********************************
2. spacer 3.1|2296320|32|CP029712|CRISPRCasFinder matches to DQ114220 (Bacteriophage F108, complete genome) position: , mismatch: 0, identity: 1.0
ggatcgatgattgctagcaagtaatctttgat CRISPR spacer
ggatcgatgattgctagcaagtaatctttgat Protospacer
********************************
3. spacer 2.1|1546650|32|CP029712|CRISPRCasFinder,CRT matches to MH238467 (Pasteurella phage Pm86, complete genome) position: , mismatch: 1, identity: 0.969
accaatctgataatcgagccaagatcgcttta CRISPR spacer
accaatctgataatcgagccaaaatcgcttta Protospacer
**********************.*********
4. spacer 2.4|1546830|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to MH238466 (Pasteurella phage AFS-2018a, complete genome) position: , mismatch: 1, identity: 0.969
gtatgagttcggcatttgcagagcttaaagct CRISPR spacer
gcatgagttcggcatttgcagagcttaaagct Protospacer
*.******************************
5. spacer 2.3|1546770|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NC_008193 (Pasteurella phage F108, complete genome) position: , mismatch: 2, identity: 0.938
agtgtaattccgctccgttgcttaaaataatc CRISPR spacer
agtgtaattccgcgccattgcttaaaataatc Protospacer
************* **.***************
6. spacer 2.3|1546770|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to DQ114220 (Bacteriophage F108, complete genome) position: , mismatch: 2, identity: 0.938
agtgtaattccgctccgttgcttaaaataatc CRISPR spacer
agtgtaattccgcgccattgcttaaaataatc Protospacer
************* **.***************
7. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX086582 (Staphylococcus aureus strain WBG1024 plasmid pWBG637, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
8. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KF831355 (Staphylococcus aureus strain A960649 plasmid pBU108a, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
9. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018563 (Staphylococcus argenteus strain 58113 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
10. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NC_013327 (Staphylococcus aureus plasmid pWBG749, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
11. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to CP030569 (Staphylococcus aureus strain ER01892.3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
12. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to CP030458 (Staphylococcus aureus strain ER04013.3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
13. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP017923 (Staphylococcus aureus strain JP02758 plasmid pJP080, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
14. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NC_013325 (Staphylococcus aureus plasmid pWBG745, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
15. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to CP030696 (Staphylococcus aureus strain ER01532.3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
16. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to CP030710 (Staphylococcus aureus strain ER01174.3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
17. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012757 (Staphylococcus aureus subsp. aureus strain JS395 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
18. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042004 (Staphylococcus aureus strain B3-14B plasmid pSALNT46, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
19. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047857 (Staphylococcus aureus strain UP_1435 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
20. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012594 (Staphylococcus aureus strain HOU1444-VR plasmid pVR-MSSA_01, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
21. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH587575 (Staphylococcus aureus strain WBG4880 plasmid pWBG637, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
22. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH587574 (Staphylococcus aureus strain WBG10514 plasmid pWBG731, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
23. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to CP030603 (Staphylococcus aureus strain ER00484.3 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
-aagagcagaaaacagaagaattggaagatgac CRISPR spacer
taacggtag-aaacagaagaatttgaatatgac Protospacer
** .*.** ************* *** *****
24. spacer 3.10|2296623|32|CP029712|PILER-CR,CRT matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 7, identity: 0.781
ataatgacgtgttcaactaacggctgacaatc CRISPR spacer
tttctgacgtgttcaactatcggctgaacata Protospacer
* *************** ******* **
25. spacer 3.10|2296623|32|CP029712|PILER-CR,CRT matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 7, identity: 0.781
ataatgacgtgttcaactaacggctgacaatc CRISPR spacer
tttctgacgtgttcaactatcggctgaacata Protospacer
* *************** ******* **
26. spacer 3.10|2296623|32|CP029712|PILER-CR,CRT matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 7, identity: 0.781
ataatgacgtgttcaactaacggctgacaatc CRISPR spacer
tttctgacgtgttcaactatcggctgaacata Protospacer
* *************** ******* **
27. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to MK905543 (Vibrio phage USC-1, complete genome) position: , mismatch: 8, identity: 0.75
aagagcagaaaacagaagaattggaagatgac CRISPR spacer
agtctgaggaaacagaagaattggaagacgat Protospacer
*. **.*******************.**.
28. spacer 2.2|1546710|32|CP029712|CRISPRCasFinder,CRT,PILER-CR matches to MK358448 (Vibrio phage 5, complete genome) position: , mismatch: 8, identity: 0.75
aagagcagaaaacagaagaattggaagatgac CRISPR spacer
agtctgaggaaacagaagaattggaagacgat Protospacer
*. **.*******************.**.
29. spacer 3.2|2296380|32|CP029712|CRISPRCasFinder matches to NZ_MF770238 (Aeromonas sobria strain JF2635 plasmid pJF2635-1, complete sequence) position: , mismatch: 8, identity: 0.75
ttccgatttttgatagtcaaagactactgagt CRISPR spacer
ctccacggcttgatactcaaagactacttagt Protospacer
.***. .****** ************ ***
30. spacer 3.4|2296532|32|CP029712|CRISPRCasFinder matches to MN694758 (Marine virus AFVG_250M853, complete genome) position: , mismatch: 8, identity: 0.75
gaaacactagaagatttaacggtcattgaaaa CRISPR spacer
aaaacactagaagatttaaaggtcgagggagg Protospacer
.****************** ****. *.*..
31. spacer 3.4|2296532|32|CP029712|CRISPRCasFinder matches to MN694774 (Marine virus AFVG_250M941, complete genome) position: , mismatch: 8, identity: 0.75
gaaacactagaagatttaacggtcattgaaaa CRISPR spacer
aaaacactagaagatttaaaggtcgagggagg Protospacer
.****************** ****. *.*..
32. spacer 3.4|2296532|32|CP029712|CRISPRCasFinder matches to MN694077 (Marine virus AFVG_250M852, complete genome) position: , mismatch: 8, identity: 0.75
gaaacactagaagatttaacggtcattgaaaa CRISPR spacer
aaaacactagaagatttaaaggtcgagggagg Protospacer
.****************** ****. *.*..
33. spacer 3.4|2296532|32|CP029712|CRISPRCasFinder matches to MN693487 (Marine virus AFVG_25M100, complete genome) position: , mismatch: 8, identity: 0.75
gaaacactagaagatttaacggtcattgaaaa CRISPR spacer
aaaacactagaagatttaaaggtcgagggagg Protospacer
.****************** ****. *.*..
34. spacer 3.4|2296532|32|CP029712|CRISPRCasFinder matches to MN694586 (Marine virus AFVG_250M370, complete genome) position: , mismatch: 8, identity: 0.75
gaaacactagaagatttaacggtcattgaaaa CRISPR spacer
aaaacactagaagatttaaaggtcgagggagg Protospacer
.****************** ****. *.*..
35. spacer 3.8|2296383|31|CP029712|PILER-CR matches to NZ_CP009919 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid pBMV_1, complete sequence) position: , mismatch: 9, identity: 0.71
ttccgatttttgatagtcaaagactactgag CRISPR spacer
gcttcatttttgatagtcatagacaactgga Protospacer
... ************** **** ****..
36. spacer 3.8|2296383|31|CP029712|PILER-CR matches to NZ_CP035096 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
ttccgatttttgatagtcaaagactactgag CRISPR spacer
gcttcatttttgatagtcatagacaactgga Protospacer
... ************** **** ****..
37. spacer 3.2|2296380|32|CP029712|CRISPRCasFinder matches to NZ_CP009919 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid pBMV_1, complete sequence) position: , mismatch: 10, identity: 0.688
ttccgatttttgatagtcaaagactactgagt CRISPR spacer
gcttcatttttgatagtcatagacaactggaa Protospacer
... ************** **** ****..
38. spacer 3.2|2296380|32|CP029712|CRISPRCasFinder matches to NZ_CP035096 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ttccgatttttgatagtcaaagactactgagt CRISPR spacer
gcttcatttttgatagtcatagacaactggaa Protospacer
... ************** **** ****..
39. spacer 3.4|2296532|32|CP029712|CRISPRCasFinder matches to NZ_CP026928 (Agrobacterium tumefaciens strain 1D1609 plasmid pAt1D1609b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaacactagaagatttaacggtcattgaaaa CRISPR spacer
tcgcggcaagaagatttaaccgtcatcgaaat Protospacer
. .* ************ *****.****
40. spacer 3.4|2296532|32|CP029712|CRISPRCasFinder matches to GU943040 (Uncultured phage MedDCM-OCT-S09-C28 genomic sequence) position: , mismatch: 10, identity: 0.688
gaaacactagaagatttaacggtcattgaaaa CRISPR spacer
gaaacactagaacttttaacggttcaggcggt Protospacer
************ *********. * ..