Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029639 Paenibacillus sp. DCT19 chromosome, complete genome 4 crisprs NA 0 2 0 0

Results visualization

1. CP029639
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029639_1 3563561-3563649 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029639_2 4500917-4501045 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029639_3 4692914-4693077 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029639_4 6065078-6065167 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029639_3 3.1|4692937|28|CP029639|CRISPRCasFinder 4692937-4692964 28 HQ259105 Escherichia phage vB_EcoP_G7C, complete genome 69517-69544 5 0.821
CP029639_3 3.3|4693029|26|CP029639|CRISPRCasFinder 4693029-4693054 26 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 656159-656184 5 0.808
CP029639_3 3.3|4693029|26|CP029639|CRISPRCasFinder 4693029-4693054 26 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 419543-419568 5 0.808
CP029639_3 3.3|4693029|26|CP029639|CRISPRCasFinder 4693029-4693054 26 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 419582-419607 5 0.808
CP029639_3 3.3|4693029|26|CP029639|CRISPRCasFinder 4693029-4693054 26 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 694486-694511 5 0.808
CP029639_3 3.3|4693029|26|CP029639|CRISPRCasFinder 4693029-4693054 26 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 36427-36452 5 0.808
CP029639_3 3.3|4693029|26|CP029639|CRISPRCasFinder 4693029-4693054 26 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 157656-157681 5 0.808

1. spacer 3.1|4692937|28|CP029639|CRISPRCasFinder matches to HQ259105 (Escherichia phage vB_EcoP_G7C, complete genome) position: , mismatch: 5, identity: 0.821 

cgtttcctgatccttcggtttaggtttg	CRISPR spacer
cgttacctgatctttcggtttagctaag	Protospacer
**** *******.********** *  *

2. spacer 3.3|4693029|26|CP029639|CRISPRCasFinder matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 5, identity: 0.808 

ttttgtcttttgttttgtccttcgtc	CRISPR spacer
ttttgtcttttgttttggtcttccaa	Protospacer
***************** .****

3. spacer 3.3|4693029|26|CP029639|CRISPRCasFinder matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 5, identity: 0.808 

ttttgtcttttgttttgtccttcgtc	CRISPR spacer
ttttgtcttttgttttggtcttccaa	Protospacer
***************** .****

4. spacer 3.3|4693029|26|CP029639|CRISPRCasFinder matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 5, identity: 0.808 

ttttgtcttttgttttgtccttcgtc	CRISPR spacer
ttttgtcttttgttttggtcttccaa	Protospacer
***************** .****

5. spacer 3.3|4693029|26|CP029639|CRISPRCasFinder matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 5, identity: 0.808 

ttttgtcttttgttttgtccttcgtc	CRISPR spacer
ttttgtcttttgttttggtcttccaa	Protospacer
***************** .****

6. spacer 3.3|4693029|26|CP029639|CRISPRCasFinder matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 5, identity: 0.808 

ttttgtcttttgttttgtccttcgtc	CRISPR spacer
ttttgtcttttgttttggtcttccaa	Protospacer
***************** .****

7. spacer 3.3|4693029|26|CP029639|CRISPRCasFinder matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 5, identity: 0.808 

ttttgtcttttgttttgtccttcgtc	CRISPR spacer
ttttgtcttttgttttggtcttccaa	Protospacer
***************** .****

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage