1. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.903
gccgcccggggcgggggccgggacc-ggcgcg CRISPR spacer
gccgcccggggcggaggacgggaccaggcgc- Protospacer
**************.** ******* *****
2. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to MT451981 (Streptomyces phage Vondra, complete genome) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gacggccggggctggggccgggaccggcggt Protospacer
* ** ******* ****************
3. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gcgaaccggggcgggagccgggaccggagcg Protospacer
** . **********.*********** ***
4. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
5. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
6. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
7. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
8. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
9. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
10. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
11. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
12. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
13. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
14. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
15. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
16. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
17. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
18. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
19. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
20. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
21. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
22. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
23. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
24. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
25. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
26. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
27. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
28. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
29. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
30. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
31. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
32. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
33. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
34. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
35. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
36. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
37. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
38. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
39. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
40. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
41. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
42. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
43. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
44. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
45. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
46. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
47. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
48. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
49. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.839
gccgcccggggcgggggccgggac-cggcgcg CRISPR spacer
cgcgcccggggccggggccgggacatggcgc- Protospacer
********** *********** .*****
50. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 5, identity: 0.839
-gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ggccgtgc-gggcgggggccgggtccggtgcg Protospacer
****. * ************** ****.***
51. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to CP003957 (Rhodococcus opacus PD630 plasmid 8, complete sequence) position: , mismatch: 5, identity: 0.828
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
gttcggccgatgagcgcagcggcggtgac Protospacer
**.********* ************ ..*
52. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP009804 (Streptomyces sp. FR-008 plasmid pSSFR2, complete sequence) position: , mismatch: 6, identity: 0.806
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gggggcgggggcgggggccgcgaccggggcg Protospacer
* * * ************* ****** ***
53. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 6, identity: 0.806
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gggagccggggcgggagccgggaccggagcg Protospacer
* . **********.*********** ***
54. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 6, identity: 0.806
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gggggccggggcgggggccggggccggggcc Protospacer
* * *****************.**** **
55. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 6, identity: 0.806
gccgcccggggcgggggccgggaccggcgcg-- CRISPR spacer
gccccccggggcggtggccggga--ggctgggc Protospacer
*** ********** ******** *** *
56. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.806
-gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgccg-ccggtgcgggggccgggacgggcttc Protospacer
**** **** ************** *** .
57. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 6, identity: 0.806
-gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcca-cgggggccggggccgggaccggagcc Protospacer
***. * ***** ************** **
58. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.793
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
cggccaccgatgcgcgcaccggcgggagc Protospacer
* .************ **********
59. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP015742 (Shinella sp. HZN7 plasmid pShin-06, complete sequence) position: , mismatch: 6, identity: 0.793
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
ggtcggccgatgcgcgcagcgccgaaatc Protospacer
* .****************** **..* *
60. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.793
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
ggccgggcgatgcgcgcaacggcggaaaa Protospacer
* **** ***********.******.*.
61. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 6, identity: 0.793
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
tttcggccgaggcgcgcagcagcgggcga Protospacer
*.******* *********.***** *
62. spacer 13.1|5361021|31|CP029378|CRISPRCasFinder matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 6, identity: 0.806
tcggcaacctcggctccatcatcgggtcggt- CRISPR spacer
tcggcaaccccggttccatcatc-gaccagtg Protospacer
*********.***.********* *..*.**
63. spacer 13.1|5361021|31|CP029378|CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
tcggcaacctcggctccatcatcgggtcggt CRISPR spacer
tgggcatcatcggctccatcatcggcccgct Protospacer
* **** * **************** .** *
64. spacer 13.1|5361021|31|CP029378|CRISPRCasFinder matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.806
tcggcaacctcggctccatcatcgggtcggt CRISPR spacer
tcggctacctcggctccaccatcacttcgct Protospacer
***** ************.****. *** *
65. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
tggggccggggccggggccgggaccggcggc Protospacer
* ******* ****************
66. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ccggtccggggcggggtccgggtccggctgg Protospacer
* *.*********** ***** ***** *
67. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
atcatccggggccggggccggggccggcggg Protospacer
..*..******* *********.****** *
68. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cagggcgggggcgggggccggcaccggcacg Protospacer
* * ************** ******.**
69. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ccggtccggggcggggtccgggtccggctgg Protospacer
* *.*********** ***** ***** *
70. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ccggtccggggcggggtccgggtccggctgg Protospacer
* *.*********** ***** ***** *
71. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gctgggttcggcgggggccgggacgggcgcg Protospacer
**.* . *************** ******
72. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
atcggccggggcaggggccgggaccgcgggg Protospacer
..** *******.************* * *
73. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcggtcggggcgggggccgggatcggggcc Protospacer
** .*****************.*** **
74. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ccggtccggggcggggtccgggtccggctgg Protospacer
* *.*********** ***** ***** *
75. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to KP027195 (Mycobacterium phage Cosmo, complete genome) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gccgcccggggctgggaccgggacgatggct Protospacer
************ ***.******* . **
76. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
77. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774
gccgc-ccggggcgggggccgggaccggcgcg CRISPR spacer
-cggcgccggggccggggccgggatcggcaac Protospacer
* ** ******* **********.****.
78. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cacggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
79. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gcaccccgggtcgggggccgagaccggtggc Protospacer
** ****** *********.******.*
80. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
81. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
82. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cacggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
83. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP047145 (Streptomyces sp. HF10 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcgagctgggccggggccgcgaccggcgcg Protospacer
** * **** ******* **********
84. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
85. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
86. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cacggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
87. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgcggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
88. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cacggtctgggcggcggccggcaccggcgcg Protospacer
** .* ****** ****** *********
89. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 7, identity: 0.774
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gcaccccgggtcgggggccgagaccggtggc Protospacer
** ****** *********.******.*
90. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
ggtcggccgatgcgcgcagcgtcggtgcg Protospacer
* .****************** *** .
91. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
92. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
93. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
94. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
95. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
96. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
atccggccgaggcgcgcggcggcgtcgcc Protospacer
.********* ******.****** . *
97. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
98. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
99. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
100. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
101. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
caccggccgatgcgcgcattggcggcctc Protospacer
**************** .***** *
102. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
atccggccgaggcgcgcggcggcgtcgcc Protospacer
.********* ******.****** . *
103. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
accattccgaggcgcgcagcggcgcgagc Protospacer
..* **** ************* ****
104. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NC_019958 (Mycobacterium sp. JS623 plasmid pMYCSM02, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
ggatggccgcggcgcgcagcggcgggact Protospacer
* .***** **************** .
105. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
atccggccgaggcgcgcggcggcgtcgcc Protospacer
.********* ******.****** . *
106. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 7, identity: 0.759
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
tgatggccgatgcgcgcaccggcgagatc Protospacer
.************** *****.** *
107. spacer 13.1|5361021|31|CP029378|CRISPRCasFinder matches to NZ_CP009431 (Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
tcggcaacctcggctccatcatcgggtcggt CRISPR spacer
tcggcaaccccggttccatcatcgacaaggg Protospacer
*********.***.**********. **
108. spacer 13.1|5361021|31|CP029378|CRISPRCasFinder matches to NZ_CP019439 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774
tcggcaacctcggctccatcatcgggtcggt-- CRISPR spacer
gcggcaacctcgacgccatcatcga--cggcct Protospacer
***********.* *********. ***.
109. spacer 1.1|40550|34|CP029378|CRISPRCasFinder matches to NC_022125 (Rhodococcus erythropolis CCM2595 plasmid pRECF1, complete sequence) position: , mismatch: 8, identity: 0.765
tgggcccggtcggggccgagtccagggctgtgag CRISPR spacer
tgtgcccggtcggggccgtgtccacgacgacgaa Protospacer
** *************** ***** *.* ..**.
110. spacer 1.1|40550|34|CP029378|CRISPRCasFinder matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.765
tgggcccggtcggggccgagtccagggctgtgag--- CRISPR spacer
ctgccccggtcggggccaaggccagggc---gagtgc Protospacer
. * *************.** ******* ***
111. spacer 1.1|40550|34|CP029378|CRISPRCasFinder matches to NZ_CP042915 (Rhodococcus qingshengii strain RL1 plasmid unnamed2) position: , mismatch: 8, identity: 0.765
tgggcccggtcggggccgagtccagggctgtgag CRISPR spacer
tgtgcccggtcggggccgtgtccacgacgacgaa Protospacer
** *************** ***** *.* ..**.
112. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgaaaccggggcggcggccgggaccggggcc Protospacer
. ********* ************ **
113. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 8, identity: 0.742
--gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cggttg--cgcggcgcgggccgggaccggcgtc Protospacer
*..* ** **** ***************.
114. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gaaggtcggggcggggaccgggaccggctgc Protospacer
* * .**********.***********
115. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cacgggcgcggcgggggccgggacgggcggc Protospacer
** ** *************** ****
116. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ggcggcctgggcgggggccgggaccccggtc Protospacer
* ** ** ***************** *.
117. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ccgggtcgcggcgggggccgggaccggctac Protospacer
* * .** *******************
118. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ccgggtcgcggcgggggccgggaccggctac Protospacer
* * .** *******************
119. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP011515 (Mitsuaria sp. 7 plasmid, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cggagccggggtgggggccggggccggcgag Protospacer
. ******.**********.****** *
120. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ggcggcctgggcgggggccgggaccccggtc Protospacer
* ** ** ***************** *.
121. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cacgggcgcggcgggggccgggacgggcggc Protospacer
** ** *************** ****
122. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
ggaacccggggcagggaccgggaccggaccc Protospacer
* .********.***.********** *
123. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 8, identity: 0.742
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
gggtcccggcgcgggggccgggacggggggc Protospacer
* ***** ************** ** *
124. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_010502 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD06, complete sequence) position: , mismatch: 8, identity: 0.742
-gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
tgaca-ccgggacgggggctgggaccggcaac Protospacer
* *. *****.*******.*********.
125. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
gcgatcagggccatggccgcgatccggtgcgg Protospacer
****** ***** *********** . * .*
126. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP020440 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
gcgatcccggcccaggccgcgatgcgggccag Protospacer
******* ***** ********* . * **
127. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 8, identity: 0.75
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
ccgcgccgggccctggccgccatcggcgtctg Protospacer
** *************** ****.** *
128. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP020372 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs485, complete sequence) position: , mismatch: 8, identity: 0.75
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
ccgcgccgggccctggccgccatcggcgtctg Protospacer
** *************** ****.** *
129. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
gcgatcccggcccaggccgcgatgcgggcaag Protospacer
******* ***** ********* . * .**
130. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP031080 (Paracoccus yeei strain CCUG 32053 plasmid pYEE2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
gcgatcccggcccaggccgcgatgcgggccag Protospacer
******* ***** ********* . * **
131. spacer 8.2|3610092|32|CP029378|PILER-CR,CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75
gtgcctgtgatggcggcgaatccgagggcggt CRISPR spacer
gcgccggtgctggcggcgaatccgaggatccc Protospacer
*.*** *** *****************.. .
132. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 8, identity: 0.724
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
tgccggccgatgcgcgcagcgccgatcca Protospacer
******************* **.
133. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP022371 (Bosea sp. AS-1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.724
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
tcaaggccgttgcgcgcagcggcggggag Protospacer
. ***** ****************..
134. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.724
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
cgtcgtccgatgcgcgcagcggcgcggaa Protospacer
.** ****************** *..
135. spacer 10.1|4890859|29|CP029378|CRISPRCasFinder matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 8, identity: 0.724
gtccggccgatgcgcgcagcggcgggagc CRISPR spacer
ccgtggccgatgcgcgcagcgtcggcaag Protospacer
. .***************** *** *.
136. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 9, identity: 0.71
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgtccccggggccggggccggggccggggac Protospacer
. ******** *********.**** *
137. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.71
gccgcccggggcgggggccgggaccggcgcg CRISPR spacer
cgggaccgggaccggggccgggaccggcaac Protospacer
* *****.* ***************.
138. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
gtcgtacgggcccgggccgcgctcgacggtca Protospacer
*. .* ******* ******* ******* .
139. spacer 8.2|3610092|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP040253 (Mycobacterium avium subsp. hominissuis strain 101115 plasmid pMARIA, complete sequence) position: , mismatch: 9, identity: 0.719
gtgcctgtgatggcggcgaatccgagggcggt CRISPR spacer
tcttcgatgatggcggcgatgccgagggcggc Protospacer
. .* .************ **********.
140. spacer 8.2|3610092|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP040245 (Mycobacterium avium subsp. hominissuis strain 101034 plasmid pMARIA, complete sequence) position: , mismatch: 9, identity: 0.719
gtgcctgtgatggcggcgaatccgagggcggt CRISPR spacer
tcttcgatgatggcggcgatgccgagggcggc Protospacer
. .* .************ **********.
141. spacer 8.2|3610092|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP040249 (Mycobacterium avium subsp. hominissuis strain 101174 plasmid pMARIA, complete sequence) position: , mismatch: 9, identity: 0.719
gtgcctgtgatggcggcgaatccgagggcggt CRISPR spacer
tcttcgatgatggcggcgatgccgagggcggc Protospacer
. .* .************ **********.
142. spacer 8.2|3610092|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 9, identity: 0.719
gtgcctgtgatggcggcgaatccgagggcggt CRISPR spacer
ccgcctgggatggcggcgaagccgacttcgaa Protospacer
.***** ************ **** **.
143. spacer 8.2|3610092|32|CP029378|PILER-CR,CRISPRCasFinder matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 9, identity: 0.719
gtgcctgtgatggcggcgaatccgagggcggt CRISPR spacer
ccgcctgggatggcggcgaagccgacttcgaa Protospacer
.***** ************ **** **.
144. spacer 13.1|5361021|31|CP029378|CRISPRCasFinder matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
tcggcaacctcggctccatcatcgggtcggt CRISPR spacer
agacgggcctgggcttcatcatcgggtcggt Protospacer
. ..*** ****.***************
145. spacer 13.1|5361021|31|CP029378|CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 9, identity: 0.71
tcggcaacctcggctccatcatcgggtcggt CRISPR spacer
tgtacaacctcggctccatccccgggtacaa Protospacer
* .**************** .***** .
146. spacer 7.1|3252741|31|CP029378|CRISPRCasFinder matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.677
gccgcccggggcgggggccgggaccggcgcg------ CRISPR spacer
------cggggccggggccggggccggggccggcgac Protospacer
****** *********.**** **
147. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
atccgccgggcccgggccgcgatcgagggctc Protospacer
.. ******** ************ **
148. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 10, identity: 0.688
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
ctcgaccgcgccctggccgagatcgacggccc Protospacer
. . *** ********** *********
149. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NC_012987 (Methylorubrum extorquens AM1 plasmid p1METDI, complete sequence) position: , mismatch: 10, identity: 0.688
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
ccctccccggccctggccgcgctcgacgccgc Protospacer
* .** ************* ****** .
150. spacer 8.1|3610031|32|CP029378|PILER-CR,CRISPRCasFinder matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gcgatccgggccctggccgcgatcgacgggag CRISPR spacer
gattgccgggctcaggccgcgatcgacgaatt Protospacer
* ******.* **************..
151. spacer 8.2|3610092|32|CP029378|PILER-CR,CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 10, identity: 0.688
gtgcctgtgatggcggcgaatccgagggcggt CRISPR spacer
aagaaccagatggcggcaaatccgagagcggg Protospacer
. * . *********.********.****
