Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP017666 Streptococcus suis strain 0061 chromosome, complete genome 4 crisprs DinG,cas9,cas1,cas2,csn2,csa3,cas3,WYL,DEDDh 1 18 3 0

Results visualization

1. CP017666
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017666_1 383115-383221 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017666_2 812098-813917 TypeII II-A
27 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017666_3 1163517-1163692 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP017666_4 1860259-1860347 Orphan NA
1 spacers
WYL

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP017666_1 1.1|383152|33|CP017666|CRISPRCasFinder 383152-383184 33 CP017666.1 533890-533922 0 1.0

1. spacer 1.1|383152|33|CP017666|CRISPRCasFinder matches to position: 533890-533922, mismatch: 0, identity: 1.0 

tgttttttatgctctttgtgtgagtgacggttc	CRISPR spacer
tgttttttatgctctttgtgtgagtgacggttc	Protospacer
*********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448816 Streptococcus phage Javan589, complete genome 4533-4562 0 1.0
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448984 Streptococcus phage Javan562, complete genome 4533-4562 0 1.0
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 EF116926 Streptococcus phage SMP, complete genome 14184-14213 0 1.0
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448985 Streptococcus phage Javan566, complete genome 5709-5738 0 1.0
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448806 Streptococcus phage Javan565, complete genome 40206-40235 0 1.0
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448808 Streptococcus phage Javan569, complete genome 31982-32011 0 1.0
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448807 Streptococcus phage Javan567, complete genome 32085-32114 0 1.0
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448991 Streptococcus phage Javan590, complete genome 32085-32114 0 1.0
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448805 Streptococcus phage Javan563, complete genome 32084-32113 0 1.0
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448803 Streptococcus phage Javan551, complete genome 4719-4748 1 0.967
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448981 Streptococcus phage Javan548, complete genome 4719-4748 1 0.967
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448810 Streptococcus phage Javan573, complete genome 5584-5613 1 0.967
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 KC348598 Streptococcus phage phi20c, complete genome 28678-28707 1 0.967
CP017666_2 2.19|813326|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813326-813355 30 MK448982 Streptococcus phage Javan554, complete genome 476-505 1 0.967
CP017666_2 2.20|813392|29|CP017666|CRISPRCasFinder,CRT,PILER-CR 813392-813420 29 MK448982 Streptococcus phage Javan554, complete genome 21815-21843 1 0.966
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448990 Streptococcus phage Javan584, complete genome 41609-41638 1 0.967
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 KC348604 Streptococcus phage phiS10, complete genome 33524-33553 1 0.967
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448815 Streptococcus phage Javan585, complete genome 30276-30305 1 0.967
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448818 Streptococcus phage Javan597, complete genome 38532-38561 1 0.967
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448988 Streptococcus phage Javan578, complete genome 34851-34880 1 0.967
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448812 Streptococcus phage Javan577, complete genome 38752-38781 1 0.967
CP017666_2 2.24|813655|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813655-813684 30 MK448990 Streptococcus phage Javan584, complete genome 18685-18714 1 0.967
CP017666_2 2.24|813655|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813655-813684 30 MK448812 Streptococcus phage Javan577, complete genome 16350-16379 1 0.967
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448829 Streptococcus phage Javan7, complete genome 4220-4249 2 0.933
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MH853355 Streptococcus phage LF1, complete genome 32498-32527 2 0.933
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 KY065464 Streptococcus phage IPP23, complete genome 7667-7696 2 0.933
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MH853358 Streptococcus phage LF4, complete genome 32498-32527 2 0.933
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MK448768 Streptococcus phage Javan47, complete genome 4439-4468 2 0.933
CP017666_2 2.4|812332|32|CP017666|CRISPRCasFinder,CRT 812332-812363 32 KC348604 Streptococcus phage phiS10, complete genome 14400-14431 2 0.938
CP017666_2 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 812797-812826 30 MK448806 Streptococcus phage Javan565, complete genome 9423-9452 2 0.933
CP017666_2 2.17|813194|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813194-813223 30 KC348604 Streptococcus phage phiS10, complete genome 24127-24156 2 0.933
CP017666_2 2.17|813194|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813194-813223 30 MK448987 Streptococcus phage Javan576, complete genome 29789-29818 3 0.9
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 MK448804 Streptococcus phage Javan553, complete genome 29393-29422 3 0.9
CP017666_2 2.2|812200|30|CP017666|CRISPRCasFinder,CRT 812200-812229 30 NZ_CP017093 Streptococcus suis strain ISU2812 plasmid pISU2812, complete sequence 5052-5081 4 0.867
CP017666_2 2.2|812200|30|CP017666|CRISPRCasFinder,CRT 812200-812229 30 KX785321 Streptococcus suis strain 6936 plasmid unnamed1, complete sequence 642-671 4 0.867
CP017666_2 2.1|812134|30|CP017666|CRISPRCasFinder,CRT 812134-812163 30 MN693609 Marine virus AFVG_250M479, complete genome 12714-12743 5 0.833
CP017666_2 2.19|813326|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813326-813355 30 MK448900 Streptococcus phage Javan290, complete genome 467-496 5 0.833
CP017666_2 2.27|813853|29|CP017666|CRT 813853-813881 29 MK448686 Streptococcus phage Javan157, complete genome 26077-26105 5 0.828
CP017666_2 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 812797-812826 30 NC_041878 Pectobacterium phage CBB, complete genome 62278-62307 6 0.8
CP017666_2 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813523-813552 30 NZ_CP017949 Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence 84354-84383 6 0.8
CP017666_2 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813523-813552 30 MN693409 Marine virus AFVG_25M351, complete genome 417-446 6 0.8
CP017666_2 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813523-813552 30 NZ_MK275621 Clostridium perfringens strain JXJA17 plasmid p3, complete sequence 61070-61099 6 0.8
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 NZ_CP021285 Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence 57384-57413 6 0.8
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 NZ_CP016869 Legionella pneumophila subsp. pneumophila strain FFI102 plasmid, complete sequence 25717-25746 6 0.8
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 NZ_CP015940 Legionella pneumophila strain C8_S plasmid unnamed1, complete sequence 49185-49214 6 0.8
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 NZ_CP021271 Legionella pneumophila strain D-7787 plasmid unnamed, complete sequence 39841-39870 6 0.8
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 NC_006366 Legionella pneumophila str. Lens plasmid pLPL, complete sequence 7744-7773 6 0.8
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 NZ_CP016871 Legionella pneumophila subsp. pneumophila strain FFI103 plasmid, complete sequence 65163-65192 6 0.8
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 NZ_CP016875 Legionella pneumophila subsp. pneumophila strain FFI329 plasmid, complete sequence 51437-51466 6 0.8
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP054613 Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence 541106-541135 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP021025 Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence 117354-117383 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013600 Rhizobium sp. N741 plasmid pRspN741e, complete sequence 223189-223218 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013504 Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence 223189-223218 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013510 Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence 221630-221659 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013521 Rhizobium sp. N113 plasmid pRspN113d, complete sequence 225877-225906 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013494 Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence 219995-220024 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013512 Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence 113303-113332 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013594 Rhizobium sp. N871 plasmid pRspN871d, complete sequence 223189-223218 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 KX827371 Staphylococcus phage SpT99F3, complete genome 22771-22800 7 0.767
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 MK075002 Staphylococcus phage phiSP38-1, complete genome 24808-24837 7 0.767
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 NZ_CP039703 Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence 733199-733228 7 0.767
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 NZ_CP013238 Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence 817198-817227 7 0.767
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 NZ_CP039706 Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence 2458-2487 7 0.767
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 NZ_CP033246 Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence 520755-520784 7 0.767
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 NZ_CP033248 Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence 520804-520833 7 0.767
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 NZ_AP019717 Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence 20669-20698 7 0.767
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 NZ_CP011146 Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence 64807-64836 7 0.767
CP017666_2 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813589-813618 30 NZ_CP010734 Phaeobacter inhibens strain P88 plasmid pP88_i, complete sequence 6221-6250 7 0.767
CP017666_2 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813721-813750 30 MK448814 Streptococcus phage Javan583, complete genome 11044-11073 7 0.767
CP017666_2 2.26|813787|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813787-813816 30 NZ_CP015352 Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence 36028-36057 7 0.767
CP017666_2 2.2|812200|30|CP017666|CRISPRCasFinder,CRT 812200-812229 30 MN694724 Marine virus AFVG_250M441, complete genome 11526-11555 8 0.733
CP017666_2 2.3|812266|30|CP017666|CRISPRCasFinder,CRT 812266-812295 30 NZ_CP047653 Bombella sp. KACC 21507 plasmid unnamed1, complete sequence 14504-14533 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP024310 Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence 768451-768480 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 1077454-1077483 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP023064 Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence 588862-588891 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP025188 Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence 174162-174191 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 610345-610374 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1839316-1839345 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP024582 Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence 230684-230713 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 1333932-1333961 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 1653882-1653911 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1474571-1474600 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP020948 Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence 127298-127327 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 MG913376 Lactobacillus phage P1174, complete genome 27625-27654 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 36847-36876 8 0.733
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 MN693244 Marine virus AFVG_25M166, complete genome 11834-11863 8 0.733
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 MN693579 Marine virus AFVG_25M167, complete genome 22248-22277 8 0.733
CP017666_2 2.10|812731|30|CP017666|CRISPRCasFinder,CRT 812731-812760 30 NZ_CP003562 Flammeovirga sp. MY04 plasmid unnamed, complete sequence 65541-65570 8 0.733
CP017666_2 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 812797-812826 30 KT870145 Roseobacter phage DSS3P8, complete genome 72583-72612 8 0.733
CP017666_2 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 812797-812826 30 MH015255 Ruegeria phage vB_RpoS-V10, complete genome 72631-72660 8 0.733
CP017666_2 2.17|813194|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813194-813223 30 NZ_CP045090 Burkholderia glumae strain GX plasmid pWSGX2, complete sequence 70702-70731 8 0.733
CP017666_2 2.19|813326|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813326-813355 30 NZ_CP020945 Pantoea ananatis strain PNA 97-1R plasmid unamed2, complete sequence 72741-72770 8 0.733
CP017666_2 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813523-813552 30 NZ_CP053834 Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence 98776-98805 8 0.733
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP042262 Litoreibacter sp. LN3S51 plasmid unnamed1, complete sequence 418527-418556 9 0.7
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP022546 Streptomyces sp. 11-1-2 plasmid unnamed1, complete sequence 5942-5971 9 0.7
CP017666_2 2.7|812533|30|CP017666|CRISPRCasFinder,CRT 812533-812562 30 NZ_CP022546 Streptomyces sp. 11-1-2 plasmid unnamed1, complete sequence 38517-38546 9 0.7
CP017666_2 2.16|813128|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813128-813157 30 NZ_CP022661 Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-1, complete sequence 98347-98376 9 0.7
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 CAJDKA010000002 Enterococcus phage 163 genome assembly, contig: phage163-genome, whole genome shotgun sequence 145446-145475 9 0.7
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 MT856905 Enterococcus phage vB_EfaM_A2, complete genome 49795-49824 9 0.7
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 MW004544 Enterococcus phage EFGrKN, complete genome 50100-50129 9 0.7
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 NC_029009 Enterococcus phage EFDG1, complete genome 50149-50178 9 0.7
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 MT909815 Enterococcus phage iF6, complete genome 40969-40998 9 0.7
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 MH880817 Enterococcus phage EfV12-phi1, complete genome 52381-52410 9 0.7
CP017666_2 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR 813457-813486 30 MN027503 Enterococcus phage vB_OCPT_Ben, complete genome 101088-101117 9 0.7

1. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448816 (Streptococcus phage Javan589, complete genome) position: , mismatch: 0, identity: 1.0 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gctagaaaatatcaaacgagaaaaacagtt	Protospacer
******************************

2. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448984 (Streptococcus phage Javan562, complete genome) position: , mismatch: 0, identity: 1.0 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gctagaaaatatcaaacgagaaaaacagtt	Protospacer
******************************

3. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to EF116926 (Streptococcus phage SMP, complete genome) position: , mismatch: 0, identity: 1.0 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gctagaaaatatcaaacgagaaaaacagtt	Protospacer
******************************

4. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448985 (Streptococcus phage Javan566, complete genome) position: , mismatch: 0, identity: 1.0 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gctagaaaatatcaaacgagaaaaacagtt	Protospacer
******************************

5. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448806 (Streptococcus phage Javan565, complete genome) position: , mismatch: 0, identity: 1.0 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatggtaa	Protospacer
******************************

6. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448808 (Streptococcus phage Javan569, complete genome) position: , mismatch: 0, identity: 1.0 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatggtaa	Protospacer
******************************

7. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448807 (Streptococcus phage Javan567, complete genome) position: , mismatch: 0, identity: 1.0 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatggtaa	Protospacer
******************************

8. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448991 (Streptococcus phage Javan590, complete genome) position: , mismatch: 0, identity: 1.0 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatggtaa	Protospacer
******************************

9. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448805 (Streptococcus phage Javan563, complete genome) position: , mismatch: 0, identity: 1.0 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatggtaa	Protospacer
******************************

10. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448803 (Streptococcus phage Javan551, complete genome) position: , mismatch: 1, identity: 0.967 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gcttgaaaatatcaaacgagaaaaacagtt	Protospacer
*** **************************

11. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448981 (Streptococcus phage Javan548, complete genome) position: , mismatch: 1, identity: 0.967 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gcttgaaaatatcaaacgagaaaaacagtt	Protospacer
*** **************************

12. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448810 (Streptococcus phage Javan573, complete genome) position: , mismatch: 1, identity: 0.967 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gcttgaaaatatcaaacgagaaaaacagtt	Protospacer
*** **************************

13. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to KC348598 (Streptococcus phage phi20c, complete genome) position: , mismatch: 1, identity: 0.967 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gcttgaaaatatcaaacgagaaaaacagtt	Protospacer
*** **************************

14. spacer 2.19|813326|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448982 (Streptococcus phage Javan554, complete genome) position: , mismatch: 1, identity: 0.967 

tcattttttctcattccagtgaaggctagc	CRISPR spacer
tcgttttttctcattccagtgaaggctagc	Protospacer
**.***************************

15. spacer 2.20|813392|29|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448982 (Streptococcus phage Javan554, complete genome) position: , mismatch: 1, identity: 0.966 

tcttgaaagctaagctaactccagcagga	CRISPR spacer
tcttgaaagctaagttaactccagcagga	Protospacer
**************.**************

16. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448990 (Streptococcus phage Javan584, complete genome) position: , mismatch: 1, identity: 0.967 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatgggaa	Protospacer
*************************** **

17. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to KC348604 (Streptococcus phage phiS10, complete genome) position: , mismatch: 1, identity: 0.967 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatggcaa	Protospacer
***************************.**

18. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448815 (Streptococcus phage Javan585, complete genome) position: , mismatch: 1, identity: 0.967 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatggcaa	Protospacer
***************************.**

19. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448818 (Streptococcus phage Javan597, complete genome) position: , mismatch: 1, identity: 0.967 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatgggaa	Protospacer
*************************** **

20. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448988 (Streptococcus phage Javan578, complete genome) position: , mismatch: 1, identity: 0.967 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctgggatacatggtaa	Protospacer
*******************.**********

21. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448812 (Streptococcus phage Javan577, complete genome) position: , mismatch: 1, identity: 0.967 

taaggagactttggctggggtacatggtaa	CRISPR spacer
taaggagactttggctggggtacatgggaa	Protospacer
*************************** **

22. spacer 2.24|813655|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448990 (Streptococcus phage Javan584, complete genome) position: , mismatch: 1, identity: 0.967 

aagagcctcaccccctttccttgtatgata	CRISPR spacer
aaaagcctcaccccctttccttgtatgata	Protospacer
**.***************************

23. spacer 2.24|813655|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448812 (Streptococcus phage Javan577, complete genome) position: , mismatch: 1, identity: 0.967 

aagagcctcaccccctttccttgtatgata	CRISPR spacer
aaaagcctcaccccctttccttgtatgata	Protospacer
**.***************************

24. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448829 (Streptococcus phage Javan7, complete genome) position: , mismatch: 2, identity: 0.933 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gatagaaaatatcaaacgtgaaaaacagtt	Protospacer
* **************** ***********

25. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MH853355 (Streptococcus phage LF1, complete genome) position: , mismatch: 2, identity: 0.933 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gatagaaaatatcaaacgtgaaaaacagtt	Protospacer
* **************** ***********

26. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to KY065464 (Streptococcus phage IPP23, complete genome) position: , mismatch: 2, identity: 0.933 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gctagagaatatcaaacgagaaaaacaatt	Protospacer
******.********************.**

27. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MH853358 (Streptococcus phage LF4, complete genome) position: , mismatch: 2, identity: 0.933 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gatagaaaatatcaaacgtgaaaaacagtt	Protospacer
* **************** ***********

28. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MK448768 (Streptococcus phage Javan47, complete genome) position: , mismatch: 2, identity: 0.933 

gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
gatagaaaatatcaaacgtgaaaaacagtt	Protospacer
* **************** ***********

29. spacer 2.4|812332|32|CP017666|CRISPRCasFinder,CRT matches to KC348604 (Streptococcus phage phiS10, complete genome) position: , mismatch: 2, identity: 0.938 

ctgtcgtttgtccacaaacaacaatagaccca	CRISPR spacer
ctgccgtctgtccacaaacaacaatagaccca	Protospacer
***.***.************************

30. spacer 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448806 (Streptococcus phage Javan565, complete genome) position: , mismatch: 2, identity: 0.933 

acgacccgctcccttgtgcttctccgtacc	CRISPR spacer
acgacccgctcccttgtgcttctccgtatt	Protospacer
****************************..

31. spacer 2.17|813194|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to KC348604 (Streptococcus phage phiS10, complete genome) position: , mismatch: 2, identity: 0.933 

ctatgatgcctgtacttaattctttcgcca	CRISPR spacer
ctatgatgcctgtacttaattcactcgcca	Protospacer
********************** .******

32. spacer 2.17|813194|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448987 (Streptococcus phage Javan576, complete genome) position: , mismatch: 3, identity: 0.9 

ctatgatgcctgtacttaattctttcgcca	CRISPR spacer
ccatgatgcctgtacttaattcctttgcca	Protospacer
*.********************.**.****

33. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448804 (Streptococcus phage Javan553, complete genome) position: , mismatch: 3, identity: 0.9 

taaggagactttggctggggtacatggtaa	CRISPR spacer
ccaggagactttggctggggtacatggcaa	Protospacer
. *************************.**

34. spacer 2.2|812200|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP017093 (Streptococcus suis strain ISU2812 plasmid pISU2812, complete sequence) position: , mismatch: 4, identity: 0.867 

ttcagttaaagaccagggcaaagggctgca	CRISPR spacer
agcagttaaggaccagggcaaagggcttca	Protospacer
  *******.***************** **

35. spacer 2.2|812200|30|CP017666|CRISPRCasFinder,CRT matches to KX785321 (Streptococcus suis strain 6936 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.867 

ttcagttaaagaccagggcaaagggctgca	CRISPR spacer
ggcagttaaggaccagggcaaagggcttca	Protospacer
  *******.***************** **

36. spacer 2.1|812134|30|CP017666|CRISPRCasFinder,CRT matches to MN693609 (Marine virus AFVG_250M479, complete genome) position: , mismatch: 5, identity: 0.833 

-gctagaaaatatcaaacgagaaaaacagtt	CRISPR spacer
cgcca-aaaatatcaaacgaggaaaactatt	Protospacer
 **.* ***************.***** .**

37. spacer 2.19|813326|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448900 (Streptococcus phage Javan290, complete genome) position: , mismatch: 5, identity: 0.833 

tcattttttctcattccagtgaaggctagc	CRISPR spacer
tctccttttctcattcctgtgaaggctagt	Protospacer
** ..************ ***********.

38. spacer 2.27|813853|29|CP017666|CRT matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 5, identity: 0.828 

cgttaaaagacaaattgatagggtagtta	CRISPR spacer
gattaaaagacaaattaatagggtaggtt	Protospacer
 .**************.********* *

39. spacer 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NC_041878 (Pectobacterium phage CBB, complete genome) position: , mismatch: 6, identity: 0.8 

acgacccgctcccttgtgcttctccgtacc	CRISPR spacer
agcactggttcccttgtgcttcttcgtacc	Protospacer
*  **. *.**************.******

40. spacer 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017949 (Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

aacggctttatatcagaaaatgaataaaga	CRISPR spacer
acttcctttatatcataaaatgaataaaaa	Protospacer
* .  ********** ************.*

41. spacer 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MN693409 (Marine virus AFVG_25M351, complete genome) position: , mismatch: 6, identity: 0.8 

aacggctttatatcagaaaatgaataaaga	CRISPR spacer
ccctgctttacatcaaaaaatgaataaaaa	Protospacer
  * ******.****.************.*

42. spacer 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK275621 (Clostridium perfringens strain JXJA17 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.8 

aacggcttt---atatcagaaaatgaataaaga	CRISPR spacer
---tcctttagaatatcagaatatgaataaaga	Protospacer
     ****   ********* ***********

43. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021285 (Legionella pneumophila subsp. pneumophila strain Allentown 1 (D-7475) plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
tggatgggtatatttcctggcttctacaaa	Protospacer
*. .********** ************.*

44. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016869 (Legionella pneumophila subsp. pneumophila strain FFI102 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
tggatgggtatatttcctggcttctacaaa	Protospacer
*. .********** ************.*

45. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015940 (Legionella pneumophila strain C8_S plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
tggatgggtatatttcctggcttctacaaa	Protospacer
*. .********** ************.*

46. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021271 (Legionella pneumophila strain D-7787 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.8 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
tggatgggtatatttcctggcttctacaaa	Protospacer
*. .********** ************.*

47. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NC_006366 (Legionella pneumophila str. Lens plasmid pLPL, complete sequence) position: , mismatch: 6, identity: 0.8 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
tggatgggtatatttcctggcttctacaaa	Protospacer
*. .********** ************.*

48. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016871 (Legionella pneumophila subsp. pneumophila strain FFI103 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
tggatgggtatatttcctggcttctacaaa	Protospacer
*. .********** ************.*

49. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016875 (Legionella pneumophila subsp. pneumophila strain FFI329 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
tggatgggtatatttcctggcttctacaaa	Protospacer
*. .********** ************.*

50. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
tgggcgctggaagacaaggacgaagaagag	Protospacer
* .***********.***** ****** .

51. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP021025 (Rhizobium sp. TAL182 plasmid pRetTAL182a, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

52. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

53. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

54. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

55. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

56. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

57. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013512 (Rhizobium sp. N1314 plasmid pRspN1314a, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

58. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagattac	Protospacer
.  ************ *.******** *.*

59. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to KX827371 (Staphylococcus phage SpT99F3, complete genome) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
tctgaattgaaagataaggaagaagaatta	Protospacer
** * ..**.******************

60. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to MK075002 (Staphylococcus phage phiSP38-1, complete genome) position: , mismatch: 7, identity: 0.767 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
tctgaattgaaagataaggaagaagaatta	Protospacer
** * ..**.******************

61. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
cagaagataagtatactgaagttcttatta	Protospacer
.  *******.**** **********  **

62. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.767 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
cagaagataagtatactgaagttcttatta	Protospacer
.  *******.**** **********  **

63. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP039706 (Clostridium butyricum strain 4-1 plasmid p-butyl_plas_4-1, complete sequence) position: , mismatch: 7, identity: 0.767 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
cagaagataagtatactgaagttcttatta	Protospacer
.  *******.**** **********  **

64. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP033246 (Clostridium butyricum strain CFSA3987 plasmid pCFSA3987, complete sequence) position: , mismatch: 7, identity: 0.767 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
cagaagataagtatactgaagttcttatta	Protospacer
.  *******.**** **********  **

65. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP033248 (Clostridium butyricum strain CFSA3989 plasmid pCFSA3989, complete sequence) position: , mismatch: 7, identity: 0.767 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
cagaagataagtatactgaagttcttatta	Protospacer
.  *******.**** **********  **

66. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to NZ_AP019717 (Clostridium butyricum strain NBRC 13949 plasmid pCBU1, complete sequence) position: , mismatch: 7, identity: 0.767 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
cagaagataagtatactgaagttcttatta	Protospacer
.  *******.**** **********  **

67. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011146 (Bacillus cereus strain FORC_013 plasmid pFORC13, complete sequence) position: , mismatch: 7, identity: 0.767 

attctgttatctggttagatagtgctaaat	CRISPR spacer
tttctgttacctgattagatagtgttttag	Protospacer
 ********.***.**********.*  *

68. spacer 2.23|813589|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010734 (Phaeobacter inhibens strain P88 plasmid pP88_i, complete sequence) position: , mismatch: 7, identity: 0.767 

taaggagactttggctggggtacatggtaa	CRISPR spacer
tgatactactttggctggtgtacatggcaa	Protospacer
*.* .  *********** ********.**

69. spacer 2.25|813721|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MK448814 (Streptococcus phage Javan583, complete genome) position: , mismatch: 7, identity: 0.767 

tatgtgggtatattacctggcttctacgat	CRISPR spacer
ctggggagcatcttacctggcttctacgat	Protospacer
.  * *.*.** ******************

70. spacer 2.26|813787|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015352 (Bacillus thuringiensis strain MYBT18246 plasmid p142098, complete sequence) position: , mismatch: 7, identity: 0.767 

tcctcagaaagggaaaacagaacttatcca	CRISPR spacer
gattgaaaaagggaaaacacaacttatccg	Protospacer
  .* *.************ *********.

71. spacer 2.2|812200|30|CP017666|CRISPRCasFinder,CRT matches to MN694724 (Marine virus AFVG_250M441, complete genome) position: , mismatch: 8, identity: 0.733 

ttcagttaaagaccagggcaaagggctgca	CRISPR spacer
ttcagttaaagaccaagacaaagtatatcc	Protospacer
***************.*.***** ..  *

72. spacer 2.3|812266|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP047653 (Bombella sp. KACC 21507 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

ttgatgtaacgtatgcagaaccatcacatt	CRISPR spacer
ataatgtaacgtctgctgaaccatcagtgc	Protospacer
 *.********* *** *********   .

73. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
caggcgctggaagaacaggaagaagaagaa	Protospacer
. .***********  *********** .

74. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
caggcgctggaagaacaggaagaagaagaa	Protospacer
. .***********  *********** .

75. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
caggcgctggaagaacaggaagaagaagaa	Protospacer
. .***********  *********** .

76. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP025188 (Roseomonas mucosa strain AD2 plasmid p1-AD2, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
gtagcgctggaagatcaggaagatgagcag	Protospacer
 .************* ******* **...

77. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
aaggcgctggaagaacaggaagaagaagaa	Protospacer
  .***********  *********** .

78. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
aaggcgctggaagaacaggaagaagaagaa	Protospacer
  .***********  *********** .

79. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
gtagcgctggaagatcaggaagatgagcag	Protospacer
 .************* ******* **...

80. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
caggcgctggaagaacaggaagaagaagaa	Protospacer
. .***********  *********** .

81. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
aaggcgctggaagaacaggaagaagaagaa	Protospacer
  .***********  *********** .

82. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
aaggcgctggaagaacaggaagaagaagaa	Protospacer
  .***********  *********** .

83. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP020948 (Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagatcac	Protospacer
.  ************ *.******** ..*

84. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to MG913376 (Lactobacillus phage P1174, complete genome) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
aaagcgctggaagctaagaaagaaggagat	Protospacer
  *********** ****.******.* ..

85. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 8, identity: 0.733 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
cgtgcgctggaagatcaagaagaagatcac	Protospacer
.  ************ *.******** ..*

86. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to MN693244 (Marine virus AFVG_25M166, complete genome) position: , mismatch: 8, identity: 0.733 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
ttcaagataaatataatgaagttcaaatag	Protospacer
**.************.********     .

87. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to MN693579 (Marine virus AFVG_25M167, complete genome) position: , mismatch: 8, identity: 0.733 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
ttcaagataaatataatgaagttcaaatag	Protospacer
**.************.********     .

88. spacer 2.10|812731|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP003562 (Flammeovirga sp. MY04 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.733 

tttaagataaatatagtgaagttctttgta	CRISPR spacer
agttgagtaaatatagtgaagttttatgta	Protospacer
  * ...****************.* ****

89. spacer 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to KT870145 (Roseobacter phage DSS3P8, complete genome) position: , mismatch: 8, identity: 0.733 

acgacccgctcccttgtgcttctccgtacc	CRISPR spacer
gagaccagcttccttgtgcttctccttcaa	Protospacer
. **** ***.************** *

90. spacer 2.11|812797|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MH015255 (Ruegeria phage vB_RpoS-V10, complete genome) position: , mismatch: 8, identity: 0.733 

acgacccgctcccttgtgcttctccgtacc	CRISPR spacer
gagaccagcttccttgtgcttctccttcaa	Protospacer
. **** ***.************** *

91. spacer 2.17|813194|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045090 (Burkholderia glumae strain GX plasmid pWSGX2, complete sequence) position: , mismatch: 8, identity: 0.733 

ctatgatgcctgtacttaattctttcgcca	CRISPR spacer
tcgccatgcctggactcaattctttcgcct	Protospacer
.... ******* ***.************

92. spacer 2.19|813326|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020945 (Pantoea ananatis strain PNA 97-1R plasmid unamed2, complete sequence) position: , mismatch: 8, identity: 0.733 

tcattttttctcattccagtgaaggctagc	CRISPR spacer
aggatttttctcattacactgaaggcttac	Protospacer
  . *********** ** ******** .*

93. spacer 2.22|813523|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053834 (Arcobacter cloacae strain LMG 26153 plasmid pACLO, complete sequence) position: , mismatch: 8, identity: 0.733 

aacggctttatatcagaaaatgaataaaga	CRISPR spacer
tatttctttatataataaaatgaataaatc	Protospacer
 *.  ******** * ************

94. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP042262 (Litoreibacter sp. LN3S51 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
gaagcgctggaagatcaggaagacaatcag	Protospacer
  ************* ******* .* ..

95. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP022546 (Streptomyces sp. 11-1-2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
gggccgctggaagatcaggaagaagcgccc	Protospacer
  . *********** ********* .. *

96. spacer 2.7|812533|30|CP017666|CRISPRCasFinder,CRT matches to NZ_CP022546 (Streptomyces sp. 11-1-2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.7 

tcagcgctggaagataaggaagaagaatgc	CRISPR spacer
gggccgctggaagatcaggaagaagcgccc	Protospacer
  . *********** ********* .. *

97. spacer 2.16|813128|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022661 (Salmonella enterica subsp. enterica strain RM11065 plasmid pRM11065-1, complete sequence) position: , mismatch: 9, identity: 0.7 

tgagatagtaagaattttgcttgtctcaca	CRISPR spacer
ggagatagtatgaatattgcttgtgatgat	Protospacer
 ********* **** ********  ..

98. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to CAJDKA010000002 (Enterococcus phage 163 genome assembly, contig: phage163-genome, whole genome shotgun sequence) position: , mismatch: 9, identity: 0.7 

attctgttatctggttagatagtgctaaat	CRISPR spacer
ggctagttatctggttagttagtgcgaaca	Protospacer
. .. ************* ****** **

99. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MT856905 (Enterococcus phage vB_EfaM_A2, complete genome) position: , mismatch: 9, identity: 0.7 

attctgttatctggttagatagtgctaaat	CRISPR spacer
gactggttatctggttagttagtgcgaaca	Protospacer
. .. ************* ****** **

100. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MW004544 (Enterococcus phage EFGrKN, complete genome) position: , mismatch: 9, identity: 0.7 

attctgttatctggttagatagtgctaaat	CRISPR spacer
gactggttatctggttagttagtgcgaaca	Protospacer
. .. ************* ****** **

101. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to NC_029009 (Enterococcus phage EFDG1, complete genome) position: , mismatch: 9, identity: 0.7 

attctgttatctggttagatagtgctaaat	CRISPR spacer
ggctagttatctggttagttagtgcgaaca	Protospacer
. .. ************* ****** **

102. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MT909815 (Enterococcus phage iF6, complete genome) position: , mismatch: 9, identity: 0.7 

attctgttatctggttagatagtgctaaat	CRISPR spacer
ggctagttatctggttagttagtgcgaaca	Protospacer
. .. ************* ****** **

103. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MH880817 (Enterococcus phage EfV12-phi1, complete genome) position: , mismatch: 9, identity: 0.7 

attctgttatctggttagatagtgctaaat	CRISPR spacer
gactggttatctggttagttagtgcgaaca	Protospacer
. .. ************* ****** **

104. spacer 2.21|813457|30|CP017666|CRISPRCasFinder,CRT,PILER-CR matches to MN027503 (Enterococcus phage vB_OCPT_Ben, complete genome) position: , mismatch: 9, identity: 0.7 

attctgttatctggttagatagtgctaaat	CRISPR spacer
gactggttatctggttagttagtgcgaaca	Protospacer
. .. ************* ****** **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 638806 : 656099 16 Streptococcus_phage(85.71%) NA NA
DBSCAN-SWA_2 788138 : 805663 17 Streptococcus_phage(100.0%) integrase attL 793296:793310|attR 816440:816454
DBSCAN-SWA_3 1375383 : 1391836 19 Streptococcus_phage(88.24%) NA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage