CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number	Prophage number	Anti-CRISPR protein number
CP024412	Glaesserella parasuis strain SH0104 chromosome, complete genome	7 crisprs	NA	15	10	0	0

Cas Category Instructions

Results visualization

1. CP024412

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP024412_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP024412_1

17530-17852

Orphan

Consensus_repeat	Method
GGCNCTGCGGGTCCAGCGGGNCCAAA	CRT

5 spacers

The CRISPR arrays of CP024412_1

>merge|CP024412|1|17530-17852|CRT
GGCTCTGCGGGTCCAGCGGGACCAAAGGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCAGGACCTGCGGGTCCAGCGGGTCCAAAAGGTGATACAGGTCAGAAAGGTGAAACTGGCCCTGCGGGTCCAGCGGGTCCAAAAGGTGATACAGGTCAGAAAGGTGAAACTGGCTCTGCGGGTCCAGCGGGACCAAAGGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCAGGCCCTGCGGGTCCAGCGGGACCTAAGGGTGACAAAGGTGATACGGGTCCAGCAGGACCACGAGGCCCTGCGGGTCCAACGGGACCACA

>CP024412|1|1|17530-17852|CRT
GGCTCTGCGGGTCCAGCGGGACCAAA	GGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCA
GGACCTGCGGGTCCAGCGGGTCCAAA	AGGTGATACAGGTCAGAAAGGTGAAACT
GGCCCTGCGGGTCCAGCGGGTCCAAA	AGGTGATACAGGTCAGAAAGGTGAAACT
GGCTCTGCGGGTCCAGCGGGACCAAA	GGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCA
GGCCCTGCGGGTCCAGCGGGACCTAA	GGGTGACAAAGGTGATACGGGTCCAGCAGGACCACGA
GGCCCTGCGGGTCCAACGGGACCACA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP024412_2

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP024412_2

717710-718032

Orphan

Consensus_repeat	Method
GGCNCTGCGGGTCCAGCGGGNCCAAA	CRT

5 spacers

The CRISPR arrays of CP024412_2

>merge|CP024412|2|717710-718032|CRT
GGCTCTGCGGGTCCAGCGGGACCAAAGGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCAGGACCTGCGGGTCCAGCGGGTCCAAAAGGTGATACAGGTCAGAAAGGTGAAACTGGCCCTGCGGGTCCAGCGGGTCCAAAAGGTGATACAGGTCAGAAAGGTGAAACTGGCTCTGCGGGTCCAGCGGGACCAAAGGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCAGGCCCTGCGGGTCCAGCGGGACCTAAGGGTGACAAAGGTGATACGGGTCCAGCAGGACCACGAGGCCCTGCGGGTCCAACGGGACCACA

>CP024412|2|2|717710-718032|CRT
GGCTCTGCGGGTCCAGCGGGACCAAA	GGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCA
GGACCTGCGGGTCCAGCGGGTCCAAA	AGGTGATACAGGTCAGAAAGGTGAAACT
GGCCCTGCGGGTCCAGCGGGTCCAAA	AGGTGATACAGGTCAGAAAGGTGAAACT
GGCTCTGCGGGTCCAGCGGGACCAAA	GGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCA
GGCCCTGCGGGTCCAGCGGGACCTAA	GGGTGACAAAGGTGATACGGGTCCAGCAGGACCACGA
GGCCCTGCGGGTCCAACGGGACCACA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP024412_3

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP024412_3

746400-746488

Orphan

Consensus_repeat	Method
CTTTTTCAAAGGGGGGATGTTAA	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP024412_3

>merge|CP024412|3|746400-746488|CRISPRCasFinder
CTTTTTCAAAGGGGGGATGTTAACGCTTTGACGGAAGTGGGGAAAAAATTTAGCCCCTTTGCCCTTCTTTTTCAAAGGGGGGAATGTTA

>CP024412|3|1|746400-746488|CRISPRCasFinder
CTTTTTCAAAGGGGGGATGTTAA	CGCTTTGACGGAAGTGGGGAAAAAATTTAGCCCCTTTGCCCTT
CTTTTTCAAAGGGGGGAATGTTA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP024412_4

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP024412_4

780504-780601

Orphan

Consensus_repeat	Method
GACATTCGGGAAGAAGCAAAACCGCCATT	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP024412_4

>merge|CP024412|4|780504-780601|CRISPRCasFinder
GACATTCGGGAAGAAGCAAAACCGCCATTACCCAATGTCACTAATGAACATTCCCCAATGGCGGAAAGCGACATTCGGGAAGAAGCAAAACCGCCATT

>CP024412|4|2|780504-780601|CRISPRCasFinder
GACATTCGGGAAGAAGCAAAACCGCCATT	ACCCAATGTCACTAATGAACATTCCCCAATGGCGGAAAGC
GACATTCGGGAAGAAGCAAAACCGCCATT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP024412_5

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP024412_5

827497-827594

Orphan

Consensus_repeat	Method
GACATTCGGGAAGAAGCAAAACCGCCATT	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP024412_5

>merge|CP024412|5|827497-827594|CRISPRCasFinder
GACATTCGGGAAGAAGCAAAACCGCCATTACCCAATGTCACTAATGAACATTCCCCAATGGCGGAAAGCGACATTCGGGAAGAAGCAAAACCGCCATT

>CP024412|5|3|827497-827594|CRISPRCasFinder
GACATTCGGGAAGAAGCAAAACCGCCATT	ACCCAATGTCACTAATGAACATTCCCCAATGGCGGAAAGC
GACATTCGGGAAGAAGCAAAACCGCCATT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP024412_7

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP024412_7

882323-882465

Orphan

Consensus_repeat	Method
CACAAGACCCTGCGGGTCCAACGGGA	CRISPRCasFinder

2 spacers

The CRISPR arrays of CP024412_7

>merge|CP024412|7|882323-882465|CRISPRCasFinder
AAACTGGCCCTGCGGGTCCAACGGGACCTAAGGGTGAACCGGGTCCTAAAGGTGAACAAGGTATTCCAGGACCTGCGGGTCCAACGGGACCACAAGACCCTGCGGGTCCAACGGGATCACAAGACCCTGCGGGTCCAACGGGA

>CP024412|7|5|882323-882465|CRISPRCasFinder
AAACTGGCCCTGCGGGTCCAACGGGA	CCTAAGGGTGAACCGGGTCCTAAAGGTGAACAAGGTA
TTCCAGGACCTGCGGGTCCAACGGGA	CCACAAGACCCTGCGGGTCCAACGGGAT
CACAAGACCCTGCGGGTCCAACGGGA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP024412_6

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP024412_6

881873-882043

Orphan

Consensus_repeat	Method
CACAAGACCCTGCGGGTCCAACGGGA	CRISPRCasFinder

3 spacers

The CRISPR arrays of CP024412_6

>merge|CP024412|6|881873-882043|CRISPRCasFinder
ATCCAGGACCTGCGGGTCCTAAAGGAGAAAAAGGAGATACAGGTCCTAGAGGTGAAACTGGTCCTGCGGGTCCAAAAGGAGAGGCAGGAGCAGTGGGCCCTCAAGGTCCTACGGGTGCAGCTGGTCCTGCGGGTCCAGCGGGACCACGAGGCCCTGCGGGTGAGCGAGGAG

>CP024412|6|4|881873-882043|CRISPRCasFinder
ATCCAGGACCTGCGGGTCCTAAAGGA	GAAAAAGGAGATACAGGTCCTAGAGGTG
AAACTGGTCCTGCGGGTCCAAAAGGA	GAGGCAGGAGCAGTGGGCC
CTCAAGGTCCTACGGGTGCAGCTGGT	CCTGCGGGTCCAGCGGGAC
CACGAGGCCCTGCGGGTGAGCGAGGAG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	CP024412.1	1423071-1423107	0	1.0
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	1679749-1679776	0	1.0
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	1679749-1679776	0	1.0
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	CP024412.1	1423071-1423107	0	1.0
CP024412_1	1.5\|17790\|37\|CP024412\|CRT	17790-17826	37	CP024412.1	856948-856984	0	1.0
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	CP024412.1	1423071-1423107	0	1.0
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	1679749-1679776	0	1.0
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	1679749-1679776	0	1.0
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	CP024412.1	1423071-1423107	0	1.0
CP024412_2	2.5\|717970\|37\|CP024412\|CRT	717970-718006	37	CP024412.1	856948-856984	0	1.0
CP024412_6	6.1\|881899\|28\|CP024412\|CRISPRCasFinder	881899-881926	28	CP024412.1	881413-881440	0	1.0
CP024412_6	6.1\|881899\|28\|CP024412\|CRISPRCasFinder	881899-881926	28	CP024412.1	2068059-2068086	0	1.0
CP024412_6	6.2\|881953\|19\|CP024412\|CRISPRCasFinder	881953-881971	19	CP024412.1	881026-881044	0	1.0
CP024412_6	6.2\|881953\|19\|CP024412\|CRISPRCasFinder	881953-881971	19	CP024412.1	881512-881530	0	1.0
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	480868-480886	0	1.0
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	1423048-1423066	0	1.0
CP024412_7	7.1\|882349\|37\|CP024412\|CRISPRCasFinder	882349-882385	37	CP024412.1	1423066-1423102	0	1.0
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	CP024412.1	941296-941332	1	0.973
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	17502-17529	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	480890-480917	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	481115-481142	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	717682-717709	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	856894-856921	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	1422864-1422891	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	1422918-1422945	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	1422972-1422999	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	17502-17529	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	480890-480917	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	481115-481142	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	717682-717709	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	856894-856921	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	1422864-1422891	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	1422918-1422945	1	0.964
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	1422972-1422999	1	0.964
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	CP024412.1	941296-941332	1	0.973
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	CP024412.1	941296-941332	1	0.973
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	17502-17529	1	0.964
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	480890-480917	1	0.964
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	481115-481142	1	0.964
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	717682-717709	1	0.964
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	856894-856921	1	0.964
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	1422864-1422891	1	0.964
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	1422918-1422945	1	0.964
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	1422972-1422999	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	17502-17529	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	480890-480917	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	481115-481142	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	717682-717709	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	856894-856921	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	1422864-1422891	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	1422918-1422945	1	0.964
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	1422972-1422999	1	0.964
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	CP024412.1	941296-941332	1	0.973
CP024412_6	6.2\|881953\|19\|CP024412\|CRISPRCasFinder	881953-881971	19	CP024412.1	940958-940976	1	0.947
CP024412_6	6.2\|881953\|19\|CP024412\|CRISPRCasFinder	881953-881971	19	CP024412.1	1204054-1204072	1	0.947
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	856988-857006	1	0.947
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	1423174-1423192	1	0.947
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	1679519-1679537	1	0.947
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	1679843-1679861	1	0.947
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	2010269-2010287	1	0.947
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	2068221-2068239	1	0.947
CP024412_7	7.1\|882349\|37\|CP024412\|CRISPRCasFinder	882349-882385	37	CP024412.1	1204207-1204243	1	0.973
CP024412_7	7.1\|882349\|37\|CP024412\|CRISPRCasFinder	882349-882385	37	CP024412.1	2067969-2068005	1	0.973
CP024412_7	7.2\|882412\|28\|CP024412\|CRISPRCasFinder	882412-882439	28	CP024412.1	480841-480868	1	0.964
CP024412_7	7.2\|882412\|28\|CP024412\|CRISPRCasFinder	882412-882439	28	CP024412.1	1679861-1679888	1	0.964
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	940828-940855	2	0.929
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	2010238-2010265	2	0.929
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	2067712-2067739	2	0.929
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	CP024412.1	2068243-2068270	2	0.929
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	940828-940855	2	0.929
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	2010238-2010265	2	0.929
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	2067712-2067739	2	0.929
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	CP024412.1	2068243-2068270	2	0.929
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	940828-940855	2	0.929
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	2010238-2010265	2	0.929
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	2067712-2067739	2	0.929
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	CP024412.1	2068243-2068270	2	0.929
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	940828-940855	2	0.929
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	2010238-2010265	2	0.929
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	2067712-2067739	2	0.929
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	CP024412.1	2068243-2068270	2	0.929
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	1022724-1022742	2	0.895
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	1423111-1423129	2	0.895
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	1679780-1679798	2	0.895
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	2010296-2010314	2	0.895
CP024412_6	6.3\|881998\|19\|CP024412\|CRISPRCasFinder	881998-882016	19	CP024412.1	2067627-2067645	2	0.895
CP024412_7	7.2\|882412\|28\|CP024412\|CRISPRCasFinder	882412-882439	28	CP024412.1	1423192-1423219	2	0.929

1. spacer 1.1|17556|37|CP024412|CRT matches to position: 1423071-1423107, mismatch: 0, identity: 1.0

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaaggtattcca	Protospacer
*************************************

2. spacer 1.2|17619|28|CP024412|CRT matches to position: 1679749-1679776, mismatch: 0, identity: 1.0

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagaaaggtgaaact	Protospacer
****************************

3. spacer 1.3|17673|28|CP024412|CRT matches to position: 1679749-1679776, mismatch: 0, identity: 1.0

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagaaaggtgaaact	Protospacer
****************************

4. spacer 1.4|17727|37|CP024412|CRT matches to position: 1423071-1423107, mismatch: 0, identity: 1.0

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaaggtattcca	Protospacer
*************************************

5. spacer 1.5|17790|37|CP024412|CRT matches to position: 856948-856984, mismatch: 0, identity: 1.0

gggtgacaaaggtgatacgggtccagcaggaccacga	CRISPR spacer
gggtgacaaaggtgatacgggtccagcaggaccacga	Protospacer
*************************************

6. spacer 2.1|717736|37|CP024412|CRT matches to position: 1423071-1423107, mismatch: 0, identity: 1.0

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaaggtattcca	Protospacer
*************************************

7. spacer 2.2|717799|28|CP024412|CRT matches to position: 1679749-1679776, mismatch: 0, identity: 1.0

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagaaaggtgaaact	Protospacer
****************************

8. spacer 2.3|717853|28|CP024412|CRT matches to position: 1679749-1679776, mismatch: 0, identity: 1.0

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagaaaggtgaaact	Protospacer
****************************

9. spacer 2.4|717907|37|CP024412|CRT matches to position: 1423071-1423107, mismatch: 0, identity: 1.0

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaaggtattcca	Protospacer
*************************************

10. spacer 2.5|717970|37|CP024412|CRT matches to position: 856948-856984, mismatch: 0, identity: 1.0

gggtgacaaaggtgatacgggtccagcaggaccacga	CRISPR spacer
gggtgacaaaggtgatacgggtccagcaggaccacga	Protospacer
*************************************

11. spacer 6.1|881899|28|CP024412|CRISPRCasFinder matches to position: 881413-881440, mismatch: 0, identity: 1.0

gaaaaaggagatacaggtcctagaggtg	CRISPR spacer
gaaaaaggagatacaggtcctagaggtg	Protospacer
****************************

12. spacer 6.1|881899|28|CP024412|CRISPRCasFinder matches to position: 2068059-2068086, mismatch: 0, identity: 1.0

gaaaaaggagatacaggtcctagaggtg	CRISPR spacer
gaaaaaggagatacaggtcctagaggtg	Protospacer
****************************

13. spacer 6.2|881953|19|CP024412|CRISPRCasFinder matches to position: 881026-881044, mismatch: 0, identity: 1.0

gaggcaggagcagtgggcc	CRISPR spacer
gaggcaggagcagtgggcc	Protospacer
*******************

14. spacer 6.2|881953|19|CP024412|CRISPRCasFinder matches to position: 881512-881530, mismatch: 0, identity: 1.0

gaggcaggagcagtgggcc	CRISPR spacer
gaggcaggagcagtgggcc	Protospacer
*******************

15. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 480868-480886, mismatch: 0, identity: 1.0

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccagcgggac	Protospacer
*******************

16. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 1423048-1423066, mismatch: 0, identity: 1.0

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccagcgggac	Protospacer
*******************

17. spacer 7.1|882349|37|CP024412|CRISPRCasFinder matches to position: 1423066-1423102, mismatch: 0, identity: 1.0

cctaagggtgaaccgggtcctaaaggtgaacaaggta	CRISPR spacer
cctaagggtgaaccgggtcctaaaggtgaacaaggta	Protospacer
*************************************

18. spacer 1.1|17556|37|CP024412|CRT matches to position: 941296-941332, mismatch: 1, identity: 0.973

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaagggattcca	Protospacer
****************************** ******

19. spacer 1.2|17619|28|CP024412|CRT matches to position: 17502-17529, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

20. spacer 1.2|17619|28|CP024412|CRT matches to position: 480890-480917, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

21. spacer 1.2|17619|28|CP024412|CRT matches to position: 481115-481142, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

22. spacer 1.2|17619|28|CP024412|CRT matches to position: 717682-717709, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

23. spacer 1.2|17619|28|CP024412|CRT matches to position: 856894-856921, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

24. spacer 1.2|17619|28|CP024412|CRT matches to position: 1422864-1422891, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

25. spacer 1.2|17619|28|CP024412|CRT matches to position: 1422918-1422945, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatgcaggtcagaaaggtgaaact	Protospacer
*******.********************

26. spacer 1.2|17619|28|CP024412|CRT matches to position: 1422972-1422999, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

27. spacer 1.3|17673|28|CP024412|CRT matches to position: 17502-17529, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

28. spacer 1.3|17673|28|CP024412|CRT matches to position: 480890-480917, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

29. spacer 1.3|17673|28|CP024412|CRT matches to position: 481115-481142, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

30. spacer 1.3|17673|28|CP024412|CRT matches to position: 717682-717709, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

31. spacer 1.3|17673|28|CP024412|CRT matches to position: 856894-856921, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

32. spacer 1.3|17673|28|CP024412|CRT matches to position: 1422864-1422891, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

33. spacer 1.3|17673|28|CP024412|CRT matches to position: 1422918-1422945, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatgcaggtcagaaaggtgaaact	Protospacer
*******.********************

34. spacer 1.3|17673|28|CP024412|CRT matches to position: 1422972-1422999, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

35. spacer 1.4|17727|37|CP024412|CRT matches to position: 941296-941332, mismatch: 1, identity: 0.973

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaagggattcca	Protospacer
****************************** ******

36. spacer 2.1|717736|37|CP024412|CRT matches to position: 941296-941332, mismatch: 1, identity: 0.973

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaagggattcca	Protospacer
****************************** ******

37. spacer 2.2|717799|28|CP024412|CRT matches to position: 17502-17529, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

38. spacer 2.2|717799|28|CP024412|CRT matches to position: 480890-480917, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

39. spacer 2.2|717799|28|CP024412|CRT matches to position: 481115-481142, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

40. spacer 2.2|717799|28|CP024412|CRT matches to position: 717682-717709, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

41. spacer 2.2|717799|28|CP024412|CRT matches to position: 856894-856921, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

42. spacer 2.2|717799|28|CP024412|CRT matches to position: 1422864-1422891, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

43. spacer 2.2|717799|28|CP024412|CRT matches to position: 1422918-1422945, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatgcaggtcagaaaggtgaaact	Protospacer
*******.********************

44. spacer 2.2|717799|28|CP024412|CRT matches to position: 1422972-1422999, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

45. spacer 2.3|717853|28|CP024412|CRT matches to position: 17502-17529, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

46. spacer 2.3|717853|28|CP024412|CRT matches to position: 480890-480917, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

47. spacer 2.3|717853|28|CP024412|CRT matches to position: 481115-481142, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

48. spacer 2.3|717853|28|CP024412|CRT matches to position: 717682-717709, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

49. spacer 2.3|717853|28|CP024412|CRT matches to position: 856894-856921, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacaggtcagagaggtgaaact	Protospacer
*****************.**********

50. spacer 2.3|717853|28|CP024412|CRT matches to position: 1422864-1422891, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

51. spacer 2.3|717853|28|CP024412|CRT matches to position: 1422918-1422945, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatgcaggtcagaaaggtgaaact	Protospacer
*******.********************

52. spacer 2.3|717853|28|CP024412|CRT matches to position: 1422972-1422999, mismatch: 1, identity: 0.964

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggtgaaact	Protospacer
*** ************************

53. spacer 2.4|717907|37|CP024412|CRT matches to position: 941296-941332, mismatch: 1, identity: 0.973

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggtgaaccgggtcctaaaggtgaacaagggattcca	Protospacer
****************************** ******

54. spacer 6.2|881953|19|CP024412|CRISPRCasFinder matches to position: 940958-940976, mismatch: 1, identity: 0.947

gaggcaggagcagtgggcc	CRISPR spacer
gaagcaggagcagtgggcc	Protospacer
**.****************

55. spacer 6.2|881953|19|CP024412|CRISPRCasFinder matches to position: 1204054-1204072, mismatch: 1, identity: 0.947

gaggcaggagcagtgggcc	CRISPR spacer
gaggcaggaccagtgggcc	Protospacer
********* *********

56. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 856988-857006, mismatch: 1, identity: 0.947

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccaacgggac	Protospacer
************.******

57. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 1423174-1423192, mismatch: 1, identity: 0.947

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccaacgggac	Protospacer
************.******

58. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 1679519-1679537, mismatch: 1, identity: 0.947

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccagctggac	Protospacer
************** ****

59. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 1679843-1679861, mismatch: 1, identity: 0.947

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccaacgggac	Protospacer
************.******

60. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 2010269-2010287, mismatch: 1, identity: 0.947

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccagcaggac	Protospacer
**************.****

61. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 2068221-2068239, mismatch: 1, identity: 0.947

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggtccaacgggac	Protospacer
************.******

62. spacer 7.1|882349|37|CP024412|CRISPRCasFinder matches to position: 1204207-1204243, mismatch: 1, identity: 0.973

cctaagggtgaaccgggtcctaaaggtgaacaaggta	CRISPR spacer
cctaagggtgaacagggtcctaaaggtgaacaaggta	Protospacer
************* ***********************

63. spacer 7.1|882349|37|CP024412|CRISPRCasFinder matches to position: 2067969-2068005, mismatch: 1, identity: 0.973

cctaagggtgaaccgggtcctaaaggtgaacaaggta	CRISPR spacer
cctaagggtgaacagggtcctaaaggtgaacaaggta	Protospacer
************* ***********************

64. spacer 7.2|882412|28|CP024412|CRISPRCasFinder matches to position: 480841-480868, mismatch: 1, identity: 0.964

ccacaagaccctgcgggtccaacgggat	CRISPR spacer
ccacaaggccctgcgggtccaacgggat	Protospacer
*******.********************

65. spacer 7.2|882412|28|CP024412|CRISPRCasFinder matches to position: 1679861-1679888, mismatch: 1, identity: 0.964

ccacaagaccctgcgggtccaacgggat	CRISPR spacer
ccacaaggccctgcgggtccaacgggat	Protospacer
*******.********************

66. spacer 1.2|17619|28|CP024412|CRT matches to position: 940828-940855, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacagatcagagaggtgaaact	Protospacer
***********.*****.**********

67. spacer 1.2|17619|28|CP024412|CRT matches to position: 2010238-2010265, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatgcaggtcagaaaggtgaaact	Protospacer
*** ***.********************

68. spacer 1.2|17619|28|CP024412|CRT matches to position: 2067712-2067739, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggagaaact	Protospacer
*** ***************** ******

69. spacer 1.2|17619|28|CP024412|CRT matches to position: 2068243-2068270, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagagaggtgaaact	Protospacer
*** *************.**********

70. spacer 1.3|17673|28|CP024412|CRT matches to position: 940828-940855, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacagatcagagaggtgaaact	Protospacer
***********.*****.**********

71. spacer 1.3|17673|28|CP024412|CRT matches to position: 2010238-2010265, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatgcaggtcagaaaggtgaaact	Protospacer
*** ***.********************

72. spacer 1.3|17673|28|CP024412|CRT matches to position: 2067712-2067739, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggagaaact	Protospacer
*** ***************** ******

73. spacer 1.3|17673|28|CP024412|CRT matches to position: 2068243-2068270, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagagaggtgaaact	Protospacer
*** *************.**********

74. spacer 2.2|717799|28|CP024412|CRT matches to position: 940828-940855, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacagatcagagaggtgaaact	Protospacer
***********.*****.**********

75. spacer 2.2|717799|28|CP024412|CRT matches to position: 2010238-2010265, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatgcaggtcagaaaggtgaaact	Protospacer
*** ***.********************

76. spacer 2.2|717799|28|CP024412|CRT matches to position: 2067712-2067739, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggagaaact	Protospacer
*** ***************** ******

77. spacer 2.2|717799|28|CP024412|CRT matches to position: 2068243-2068270, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagagaggtgaaact	Protospacer
*** *************.**********

78. spacer 2.3|717853|28|CP024412|CRT matches to position: 940828-940855, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgatacagatcagagaggtgaaact	Protospacer
***********.*****.**********

79. spacer 2.3|717853|28|CP024412|CRT matches to position: 2010238-2010265, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatgcaggtcagaaaggtgaaact	Protospacer
*** ***.********************

80. spacer 2.3|717853|28|CP024412|CRT matches to position: 2067712-2067739, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagaaaggagaaact	Protospacer
*** ***************** ******

81. spacer 2.3|717853|28|CP024412|CRT matches to position: 2068243-2068270, mismatch: 2, identity: 0.929

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggagatacaggtcagagaggtgaaact	Protospacer
*** *************.**********

82. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 1022724-1022742, mismatch: 2, identity: 0.895

cctgcgggtccagcgggac	CRISPR spacer
ccagtgggtccagcgggac	Protospacer
** *.**************

83. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 1423111-1423129, mismatch: 2, identity: 0.895

cctgcgggtccagcgggac	CRISPR spacer
cctgcgggcccaacgggac	Protospacer
********.***.******

84. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 1679780-1679798, mismatch: 2, identity: 0.895

cctgcgggtccagcgggac	CRISPR spacer
cctacgggtccaacgggac	Protospacer
***.********.******

85. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 2010296-2010314, mismatch: 2, identity: 0.895

cctgcgggtccagcgggac	CRISPR spacer
cctgtgggtccaacgggac	Protospacer
****.*******.******

86. spacer 6.3|881998|19|CP024412|CRISPRCasFinder matches to position: 2067627-2067645, mismatch: 2, identity: 0.895

cctgcgggtccagcgggac	CRISPR spacer
cctacgggtccaacgggac	Protospacer
***.********.******

87. spacer 7.2|882412|28|CP024412|CRISPRCasFinder matches to position: 1423192-1423219, mismatch: 2, identity: 0.929

ccacaagaccctgcgggtccaacgggat	CRISPR spacer
ccacaaggacctgcgggtccaacgggat	Protospacer
*******. *******************

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP024412_6	6.1\|881899\|28\|CP024412\|CRISPRCasFinder	881899-881926	28	MK017820	Clostridium phage CPD7, complete genome	17562-17589	2	0.929
CP024412_6	6.1\|881899\|28\|CP024412\|CRISPRCasFinder	881899-881926	28	MH393889	Clostridium phage susfortuna, complete genome	1323-1350	2	0.929
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	MH319755	Marine virus AG-345-L05 Ga0172272_12 genomic sequence	26266-26293	4	0.857
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	MH319755	Marine virus AG-345-L05 Ga0172272_12 genomic sequence	26266-26293	4	0.857
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	MH319755	Marine virus AG-345-L05 Ga0172272_12 genomic sequence	26266-26293	4	0.857
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	MH319755	Marine virus AG-345-L05 Ga0172272_12 genomic sequence	26266-26293	4	0.857
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	MG592475	Vibrio phage 1.103.O._10N.261.52.F2, partial genome	17010-17037	5	0.821
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	NC_031922	Synechococcus phage S-CAM9 isolate 1109NB16, complete genome	31621-31648	5	0.821
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	KU686204	Synechococcus phage S-CAM9 isolate 0808SB05, complete genome	31621-31648	5	0.821
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	KU686205	Synechococcus phage S-CAM9 isolate 0908SB82, complete genome	31621-31648	5	0.821
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	HQ633061	Synechococcus phage S-CBM2, * SEQUENCING IN PROGRESS *, 6 unordered pieces	130083-130110	5	0.821
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	MG592475	Vibrio phage 1.103.O._10N.261.52.F2, partial genome	17010-17037	5	0.821
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	NC_031922	Synechococcus phage S-CAM9 isolate 1109NB16, complete genome	31621-31648	5	0.821
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	KU686204	Synechococcus phage S-CAM9 isolate 0808SB05, complete genome	31621-31648	5	0.821
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	KU686205	Synechococcus phage S-CAM9 isolate 0908SB82, complete genome	31621-31648	5	0.821
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	HQ633061	Synechococcus phage S-CBM2, * SEQUENCING IN PROGRESS *, 6 unordered pieces	130083-130110	5	0.821
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	MG592475	Vibrio phage 1.103.O._10N.261.52.F2, partial genome	17010-17037	5	0.821
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	NC_031922	Synechococcus phage S-CAM9 isolate 1109NB16, complete genome	31621-31648	5	0.821
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	KU686204	Synechococcus phage S-CAM9 isolate 0808SB05, complete genome	31621-31648	5	0.821
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	KU686205	Synechococcus phage S-CAM9 isolate 0908SB82, complete genome	31621-31648	5	0.821
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	HQ633061	Synechococcus phage S-CBM2, * SEQUENCING IN PROGRESS *, 6 unordered pieces	130083-130110	5	0.821
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	MG592475	Vibrio phage 1.103.O._10N.261.52.F2, partial genome	17010-17037	5	0.821
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	NC_031922	Synechococcus phage S-CAM9 isolate 1109NB16, complete genome	31621-31648	5	0.821
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	KU686204	Synechococcus phage S-CAM9 isolate 0808SB05, complete genome	31621-31648	5	0.821
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	KU686205	Synechococcus phage S-CAM9 isolate 0908SB82, complete genome	31621-31648	5	0.821
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	HQ633061	Synechococcus phage S-CBM2, * SEQUENCING IN PROGRESS *, 6 unordered pieces	130083-130110	5	0.821
CP024412_6	6.1\|881899\|28\|CP024412\|CRISPRCasFinder	881899-881926	28	MK448694	Streptococcus phage Javan179, complete genome	32712-32739	5	0.821
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	NZ_CP009619	Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence	360491-360518	6	0.786
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	NZ_CP009619	Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence	360491-360518	6	0.786
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	NZ_CP009619	Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence	360491-360518	6	0.786
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	NZ_CP009619	Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence	360491-360518	6	0.786
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	MG592407	Vibrio phage 1.023.O._10N.222.51.B4, partial genome	17523-17550	7	0.75
CP024412_1	1.2\|17619\|28\|CP024412\|CRT	17619-17646	28	MG592476	Vibrio phage 1.104.O._10N.286.49.A12, partial genome	16281-16308	7	0.75
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	MG592407	Vibrio phage 1.023.O._10N.222.51.B4, partial genome	17523-17550	7	0.75
CP024412_1	1.3\|17673\|28\|CP024412\|CRT	17673-17700	28	MG592476	Vibrio phage 1.104.O._10N.286.49.A12, partial genome	16281-16308	7	0.75
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	MG592407	Vibrio phage 1.023.O._10N.222.51.B4, partial genome	17523-17550	7	0.75
CP024412_2	2.2\|717799\|28\|CP024412\|CRT	717799-717826	28	MG592476	Vibrio phage 1.104.O._10N.286.49.A12, partial genome	16281-16308	7	0.75
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	MG592407	Vibrio phage 1.023.O._10N.222.51.B4, partial genome	17523-17550	7	0.75
CP024412_2	2.3\|717853\|28\|CP024412\|CRT	717853-717880	28	MG592476	Vibrio phage 1.104.O._10N.286.49.A12, partial genome	16281-16308	7	0.75
CP024412_7	7.1\|882349\|37\|CP024412\|CRISPRCasFinder	882349-882385	37	MT774376	CrAssphage cr55_1, complete genome	95727-95763	7	0.811
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	MT774380	CrAssphage cr1_1, complete genome	19-55	9	0.757
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	CP029253	Streptococcus phage VS-2018a, complete genome	32656-32692	9	0.757
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	KY705287	Streptococcus phage P9854, complete genome	17426-17462	9	0.757
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	KY705287	Streptococcus phage P9854, complete genome	18848-18884	9	0.757
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	KY705284	Streptococcus phage P9851, complete genome	16303-16339	9	0.757
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	KY705286	Streptococcus phage P9853, complete genome	17163-17199	9	0.757
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	KY705286	Streptococcus phage P9853, complete genome	18066-18102	9	0.757
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	MT774380	CrAssphage cr1_1, complete genome	19-55	9	0.757
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	CP029253	Streptococcus phage VS-2018a, complete genome	32656-32692	9	0.757
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	KY705287	Streptococcus phage P9854, complete genome	17426-17462	9	0.757
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	KY705287	Streptococcus phage P9854, complete genome	18848-18884	9	0.757
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	KY705284	Streptococcus phage P9851, complete genome	16303-16339	9	0.757
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	KY705286	Streptococcus phage P9853, complete genome	17163-17199	9	0.757
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	KY705286	Streptococcus phage P9853, complete genome	18066-18102	9	0.757
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	MT774380	CrAssphage cr1_1, complete genome	19-55	9	0.757
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	CP029253	Streptococcus phage VS-2018a, complete genome	32656-32692	9	0.757
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	KY705287	Streptococcus phage P9854, complete genome	17426-17462	9	0.757
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	KY705287	Streptococcus phage P9854, complete genome	18848-18884	9	0.757
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	KY705284	Streptococcus phage P9851, complete genome	16303-16339	9	0.757
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	KY705286	Streptococcus phage P9853, complete genome	17163-17199	9	0.757
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	KY705286	Streptococcus phage P9853, complete genome	18066-18102	9	0.757
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	MT774380	CrAssphage cr1_1, complete genome	19-55	9	0.757
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	CP029253	Streptococcus phage VS-2018a, complete genome	32656-32692	9	0.757
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	KY705287	Streptococcus phage P9854, complete genome	17426-17462	9	0.757
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	KY705287	Streptococcus phage P9854, complete genome	18848-18884	9	0.757
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	KY705284	Streptococcus phage P9851, complete genome	16303-16339	9	0.757
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	KY705286	Streptococcus phage P9853, complete genome	17163-17199	9	0.757
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	KY705286	Streptococcus phage P9853, complete genome	18066-18102	9	0.757
CP024412_7	7.1\|882349\|37\|CP024412\|CRISPRCasFinder	882349-882385	37	MT774380	CrAssphage cr1_1, complete genome	99828-99864	9	0.757
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	MT774376	CrAssphage cr55_1, complete genome	95722-95758	10	0.73
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	MT774380	CrAssphage cr1_1, complete genome	99823-99859	10	0.73
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	MT774376	CrAssphage cr55_1, complete genome	95722-95758	10	0.73
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	MT774380	CrAssphage cr1_1, complete genome	99823-99859	10	0.73
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	MT774376	CrAssphage cr55_1, complete genome	95722-95758	10	0.73
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	MT774380	CrAssphage cr1_1, complete genome	99823-99859	10	0.73
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	MT774376	CrAssphage cr55_1, complete genome	95722-95758	10	0.73
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	MT774380	CrAssphage cr1_1, complete genome	99823-99859	10	0.73
CP024412_7	7.1\|882349\|37\|CP024412\|CRISPRCasFinder	882349-882385	37	MT774380	CrAssphage cr1_1, complete genome	24-60	10	0.73
CP024412_7	7.1\|882349\|37\|CP024412\|CRISPRCasFinder	882349-882385	37	MT774380	CrAssphage cr1_1, complete genome	1-33	11	0.703
CP024412_1	1.1\|17556\|37\|CP024412\|CRT	17556-17592	37	MT774380	CrAssphage cr1_1, complete genome	1-28	13	0.649
CP024412_1	1.4\|17727\|37\|CP024412\|CRT	17727-17763	37	MT774380	CrAssphage cr1_1, complete genome	1-28	13	0.649
CP024412_2	2.1\|717736\|37\|CP024412\|CRT	717736-717772	37	MT774380	CrAssphage cr1_1, complete genome	1-28	13	0.649
CP024412_2	2.4\|717907\|37\|CP024412\|CRT	717907-717943	37	MT774380	CrAssphage cr1_1, complete genome	1-28	13	0.649

1. spacer 6.1|881899|28|CP024412|CRISPRCasFinder matches to MK017820 (Clostridium phage CPD7, complete genome) position: , mismatch: 2, identity: 0.929

gaaaaaggagatacaggtcctagaggtg	CRISPR spacer
aaaaaaggagatacaggtcctagaggtc	Protospacer
.**************************

2. spacer 6.1|881899|28|CP024412|CRISPRCasFinder matches to MH393889 (Clostridium phage susfortuna, complete genome) position: , mismatch: 2, identity: 0.929

gaaaaaggagatacaggtcctagaggtg	CRISPR spacer
aaaaaaggagatacaggtcctagaggtc	Protospacer
.**************************

3. spacer 1.2|17619|28|CP024412|CRT matches to MH319755 (Marine virus AG-345-L05 Ga0172272_12 genomic sequence) position: , mismatch: 4, identity: 0.857

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgataagggtcagaaaggtgaaaag	Protospacer
******** .****************

4. spacer 1.3|17673|28|CP024412|CRT matches to MH319755 (Marine virus AG-345-L05 Ga0172272_12 genomic sequence) position: , mismatch: 4, identity: 0.857

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgataagggtcagaaaggtgaaaag	Protospacer
******** .****************

5. spacer 2.2|717799|28|CP024412|CRT matches to MH319755 (Marine virus AG-345-L05 Ga0172272_12 genomic sequence) position: , mismatch: 4, identity: 0.857

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgataagggtcagaaaggtgaaaag	Protospacer
******** .****************

6. spacer 2.3|717853|28|CP024412|CRT matches to MH319755 (Marine virus AG-345-L05 Ga0172272_12 genomic sequence) position: , mismatch: 4, identity: 0.857

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgataagggtcagaaaggtgaaaag	Protospacer
******** .****************

7. spacer 1.2|17619|28|CP024412|CRT matches to MG592475 (Vibrio phage 1.103.O._10N.261.52.F2, partial genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgctccaggtcagaaaggtgaatac	Protospacer
***** * *****************  .

8. spacer 1.2|17619|28|CP024412|CRT matches to NC_031922 (Synechococcus phage S-CAM9 isolate 1109NB16, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

9. spacer 1.2|17619|28|CP024412|CRT matches to KU686204 (Synechococcus phage S-CAM9 isolate 0808SB05, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

10. spacer 1.2|17619|28|CP024412|CRT matches to KU686205 (Synechococcus phage S-CAM9 isolate 0908SB82, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

11. spacer 1.2|17619|28|CP024412|CRT matches to HQ633061 (Synechococcus phage S-CBM2, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aactgatgcaggtcagaagggtgaaatt	Protospacer
*. ****.**********.*******.*

12. spacer 1.3|17673|28|CP024412|CRT matches to MG592475 (Vibrio phage 1.103.O._10N.261.52.F2, partial genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgctccaggtcagaaaggtgaatac	Protospacer
***** * *****************  .

13. spacer 1.3|17673|28|CP024412|CRT matches to NC_031922 (Synechococcus phage S-CAM9 isolate 1109NB16, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

14. spacer 1.3|17673|28|CP024412|CRT matches to KU686204 (Synechococcus phage S-CAM9 isolate 0808SB05, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

15. spacer 1.3|17673|28|CP024412|CRT matches to KU686205 (Synechococcus phage S-CAM9 isolate 0908SB82, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

16. spacer 1.3|17673|28|CP024412|CRT matches to HQ633061 (Synechococcus phage S-CBM2, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aactgatgcaggtcagaagggtgaaatt	Protospacer
*. ****.**********.*******.*

17. spacer 2.2|717799|28|CP024412|CRT matches to MG592475 (Vibrio phage 1.103.O._10N.261.52.F2, partial genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgctccaggtcagaaaggtgaatac	Protospacer
***** * *****************  .

18. spacer 2.2|717799|28|CP024412|CRT matches to NC_031922 (Synechococcus phage S-CAM9 isolate 1109NB16, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

19. spacer 2.2|717799|28|CP024412|CRT matches to KU686204 (Synechococcus phage S-CAM9 isolate 0808SB05, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

20. spacer 2.2|717799|28|CP024412|CRT matches to KU686205 (Synechococcus phage S-CAM9 isolate 0908SB82, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

21. spacer 2.2|717799|28|CP024412|CRT matches to HQ633061 (Synechococcus phage S-CBM2, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aactgatgcaggtcagaagggtgaaatt	Protospacer
*. ****.**********.*******.*

22. spacer 2.3|717853|28|CP024412|CRT matches to MG592475 (Vibrio phage 1.103.O._10N.261.52.F2, partial genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aggtgctccaggtcagaaaggtgaatac	Protospacer
***** * *****************  .

23. spacer 2.3|717853|28|CP024412|CRT matches to NC_031922 (Synechococcus phage S-CAM9 isolate 1109NB16, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

24. spacer 2.3|717853|28|CP024412|CRT matches to KU686204 (Synechococcus phage S-CAM9 isolate 0808SB05, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

25. spacer 2.3|717853|28|CP024412|CRT matches to KU686205 (Synechococcus phage S-CAM9 isolate 0908SB82, complete genome) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
gggtgataaaggtcagaagggtgaactt	Protospacer
.******* *********.****** .*

26. spacer 2.3|717853|28|CP024412|CRT matches to HQ633061 (Synechococcus phage S-CBM2, *** SEQUENCING IN PROGRESS ***, 6 unordered pieces) position: , mismatch: 5, identity: 0.821

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aactgatgcaggtcagaagggtgaaatt	Protospacer
*. ****.**********.*******.*

27. spacer 6.1|881899|28|CP024412|CRISPRCasFinder matches to MK448694 (Streptococcus phage Javan179, complete genome) position: , mismatch: 5, identity: 0.821

gaaaaaggagatacaggtcctagaggtg	CRISPR spacer
tctaaaggagatactggtcctaaaggtg	Protospacer
   *********** *******.*****

28. spacer 1.2|17619|28|CP024412|CRT matches to NZ_CP009619 (Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence) position: , mismatch: 6, identity: 0.786

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aatggcgacaggtcagataggtgaaact	Protospacer
*.  *  ********** **********

29. spacer 1.3|17673|28|CP024412|CRT matches to NZ_CP009619 (Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence) position: , mismatch: 6, identity: 0.786

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aatggcgacaggtcagataggtgaaact	Protospacer
*.  *  ********** **********

30. spacer 2.2|717799|28|CP024412|CRT matches to NZ_CP009619 (Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence) position: , mismatch: 6, identity: 0.786

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aatggcgacaggtcagataggtgaaact	Protospacer
*.  *  ********** **********

31. spacer 2.3|717853|28|CP024412|CRT matches to NZ_CP009619 (Vibrio coralliilyticus strain RE98 plasmid p380, complete sequence) position: , mismatch: 6, identity: 0.786

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
aatggcgacaggtcagataggtgaaact	Protospacer
*.  *  ********** **********

32. spacer 1.2|17619|28|CP024412|CRT matches to MG592407 (Vibrio phage 1.023.O._10N.222.51.B4, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
cggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

33. spacer 1.2|17619|28|CP024412|CRT matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
tggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

34. spacer 1.3|17673|28|CP024412|CRT matches to MG592407 (Vibrio phage 1.023.O._10N.222.51.B4, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
cggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

35. spacer 1.3|17673|28|CP024412|CRT matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
tggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

36. spacer 2.2|717799|28|CP024412|CRT matches to MG592407 (Vibrio phage 1.023.O._10N.222.51.B4, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
cggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

37. spacer 2.2|717799|28|CP024412|CRT matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
tggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

38. spacer 2.3|717853|28|CP024412|CRT matches to MG592407 (Vibrio phage 1.023.O._10N.222.51.B4, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
cggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

39. spacer 2.3|717853|28|CP024412|CRT matches to MG592476 (Vibrio phage 1.104.O._10N.286.49.A12, partial genome) position: , mismatch: 7, identity: 0.75

aggtgatacaggtcagaaaggtgaaact	CRISPR spacer
tggtgaagcaggtcagaaaggtgagtac	Protospacer
 ***** .****************.  .

40. spacer 7.1|882349|37|CP024412|CRISPRCasFinder matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 7, identity: 0.811

cctaagggtgaaccgggtcctaaaggtgaacaaggta	CRISPR spacer
tctaagggggaacctggtcctaaaggtgaaccgggag	Protospacer
.******* ***** **************** .** .

41. spacer 1.1|17556|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagaacct	Protospacer
*** ***** **************** .** .  **

42. spacer 1.1|17556|37|CP024412|CRT matches to CP029253 (Streptococcus phage VS-2018a, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

43. spacer 1.1|17556|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

44. spacer 1.1|17556|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

45. spacer 1.1|17556|37|CP024412|CRT matches to KY705284 (Streptococcus phage P9851, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

46. spacer 1.1|17556|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

47. spacer 1.1|17556|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

48. spacer 1.4|17727|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagaacct	Protospacer
*** ***** **************** .** .  **

49. spacer 1.4|17727|37|CP024412|CRT matches to CP029253 (Streptococcus phage VS-2018a, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

50. spacer 1.4|17727|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

51. spacer 1.4|17727|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

52. spacer 1.4|17727|37|CP024412|CRT matches to KY705284 (Streptococcus phage P9851, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

53. spacer 1.4|17727|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

54. spacer 1.4|17727|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

55. spacer 2.1|717736|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagaacct	Protospacer
*** ***** **************** .** .  **

56. spacer 2.1|717736|37|CP024412|CRT matches to CP029253 (Streptococcus phage VS-2018a, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

57. spacer 2.1|717736|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

58. spacer 2.1|717736|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

59. spacer 2.1|717736|37|CP024412|CRT matches to KY705284 (Streptococcus phage P9851, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

60. spacer 2.1|717736|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

61. spacer 2.1|717736|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

62. spacer 2.4|717907|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagaacct	Protospacer
*** ***** **************** .** .  **

63. spacer 2.4|717907|37|CP024412|CRT matches to CP029253 (Streptococcus phage VS-2018a, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

64. spacer 2.4|717907|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

65. spacer 2.4|717907|37|CP024412|CRT matches to KY705287 (Streptococcus phage P9854, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

66. spacer 2.4|717907|37|CP024412|CRT matches to KY705284 (Streptococcus phage P9851, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

67. spacer 2.4|717907|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

68. spacer 2.4|717907|37|CP024412|CRT matches to KY705286 (Streptococcus phage P9853, complete genome) position: , mismatch: 9, identity: 0.757

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
aggaccacaaggtcctaaaggtgaccaaggtatacct	Protospacer
.**   ** .************** ******** **

69. spacer 7.1|882349|37|CP024412|CRISPRCasFinder matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 9, identity: 0.757

---cctaagggtgaaccgggtcctaaaggtgaacaaggta	CRISPR spacer
gaacc---gggagaacctggtcctaaaggtgaaccgggag	Protospacer
   **   *** ***** **************** .** .

70. spacer 1.1|17556|37|CP024412|CRT matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggggaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

71. spacer 1.1|17556|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

72. spacer 1.4|17727|37|CP024412|CRT matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggggaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

73. spacer 1.4|17727|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

74. spacer 2.1|717736|37|CP024412|CRT matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggggaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

75. spacer 2.1|717736|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

76. spacer 2.4|717907|37|CP024412|CRT matches to MT774376 (CrAssphage cr55_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggggaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

77. spacer 2.4|717907|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 10, identity: 0.73

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccgggagctgat	Protospacer
*** ***** **************** .** ..*

78. spacer 7.1|882349|37|CP024412|CRISPRCasFinder matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 10, identity: 0.73

cctaagggtgaaccgggtcctaaaggtgaacaaggta	CRISPR spacer
gaacagggagaacctggtcctaaaggtgaaccgggag	Protospacer
    **** ***** **************** .** .

79. spacer 7.1|882349|37|CP024412|CRISPRCasFinder matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 11, identity: 0.703

---cctaagggtgaaccgggtcctaaaggtgaacaaggta	CRISPR spacer
gaacc---gggagaacctggtcctaaaggtgaaccg----	Protospacer
   **   *** ***** **************** .

80. spacer 1.1|17556|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 13, identity: 0.649

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccg---------	Protospacer
*** ***** **************** .

81. spacer 1.4|17727|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 13, identity: 0.649

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccg---------	Protospacer
*** ***** **************** .

82. spacer 2.1|717736|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 13, identity: 0.649

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccg---------	Protospacer
*** ***** **************** .

83. spacer 2.4|717907|37|CP024412|CRT matches to MT774380 (CrAssphage cr1_1, complete genome) position: , mismatch: 13, identity: 0.649

gggtgaaccgggtcctaaaggtgaacaaggtattcca	CRISPR spacer
gggagaacctggtcctaaaggtgaaccg---------	Protospacer
*** ***** **************** .

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage